ZFIN ID: ZDB-TSCRIPT-090929-10731
Transcript Name: slc9a7-202
Previous Name: slc9a7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028217 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028217|OTTDARG00000022004|ZDB-GENE-050913-8 slc9a7|OTTDARP00000023077 DKEY-62E6.4-001 LG_ BX322552.6 Danio rerio protein_coding KNOWN, 4108 bp
ATGCCCATTATTGCCTGTGACTGTACCTGACGCAGCTGAA
GCAGTGAGTGAGGAAACCCGCCGCCAGCATCCTGCACCAT
GGAGGCGGCCAAAGCACCAAAGCCATGGACGTTATATTTA
CCGAATCCCAGCTCGCTGTTTCCTCTCTTCGTGTTCATTT
TAAGCCAATGTTATCGGATAAGCGCAGACGACGGCGGCAT
AGAAGAACTTGCAACGGAGAAAGAAGCAGAGGAAAGTCAC
AGGCAGGACAGCGTGAATTTACTCACATTCATTTTGCTTT
TGACACTCACTATACTCACAATATGGCTCTTCAAACACAG
AAGAGTGCGCTTCCTGCACGAAACCGGACTGGCAATGATA
TACGGTCTGTTGGTGGGTGTTATTTTGAGGTATGGCATTC
CCTCCACCAGCTACCATAATAAAACTCCTCCGAGCTGCAT
GCTGAAGGAGGGTCCTGTCAGCACTGTGCTTCTCAATGTT
AGCGGGAAGTTCTTTGAATACACGCTCAAAGGGGAGATCA
ACCTTCGAGAAATCCACAGTGTGGAGCAGAATGACATGTT
GCGCAAGCTGACCTTTGACCCAGAGGTTTTCTTCAATATT
CTGCTACCTCCCATCATTTTCCATGCCGGATACAGCCTCA
AGAAGAGACACTTCTTCAGGAACCTGGGATCCATCATAAC
GTATGCCTTCCTGGGCACTGCAATTTCCTGTTTTGTCATC
GGAAACCTCATGTATGGCGTGGTAAAACTGATGCAGGTTT
TGGGTCAACTCACAGACAAGTTTTACTACACGGACTGTCT
GTTTTTTGGTGCCATCATATCTGCCACAGACCCAGTCACC
GTGCTTGCGATCTTTAATGAGCTCCATGCTGATGGGGATC
TCTACGCTCTGCTGTTTGGAGAGAGTGTCATGAACGATGC
GGTCTCCATAGTGCTTTCATCGTCGATTGTGGCATATCAG
CCTTCAGGAGCCAACACACACACATTCGATGCCTCTGCCT
TCTTCAAATCGGTGGGCGTCTTCATAGGCATCTTCAGCGG
CTCTTTTGCTATGGGTGCAGTCACTGGTGTGGTCACCGCG
CTTGTGACAAAATTCACCAAGCTGCACTGTTTTCCTCTAC
TGGAGACGGCTTTGTTCTTCCTCATGTCCTGGAGTACTTT
TCTACTGGCTGAAGCATGTGGCTTCACAGGTGTTGTCGCT
GTGCTGTTTTGTGGAATCACACAAGCTCACTATACCTACA
ACAATCTCTCAGAGGAGTCGACCAAACGCACTAAACAGTT
GTTTGAGGTGTTGCACTTCCTGGCTGAGAACTTCATCTTC
TCCTACATGGGCCTAGCACTCTTCACTTTCCAGAATCACG
TCTTCAGCCCTATTTTCATAGTTGGAGCCTTTCTAGCCAT
CTTCATCGGCCGGGCCTTGAACATCTACCCCTTATCTTTT
CTGATTAACCTGGGCCGAAGACACAAAATCCGAGGAAACT
TTCAGCACATGATGATGTTCGCAGGGCTGCGAGGGGCTAT
GGCGTTCGCTCTGGCCATTCGTGACACTGCCACATACGCG
CGGCAGATGATGTTCACTACGACCCTGCTCATTGTGTTCT
TCACAGTGTGGGTGTTCGGAGGAGGCACCACGCCAATGCT
ATCCTGGCTGCACATCAGGGTTGGAGAGTCTTCTGATGCT
GAGAAGGAGAGGATGCGTAGACTGTGGAATTACGACAGCA
GAGTTGGAGTGGACCCCGATCAGGATCTTCAGCCATGCGG
GGACAGCTTCCAGGTCCTTCAGGGAGATGGGAGCCAGTCA
GAAGGGCAGAGCAAGACCAAGCAGGAGAGCGCCTGGCTTT
TCAGACTTTGGTATACTTTTGACCACAATTACCTGAAGCC
TATCCTGACCCATAGCGGACCCCCTCTGACCTCCACCCTG
CCCGCCTGCTGCGGCCCATTGGCTCGATGTCTGACCAGCC
CTCAAGCATATGAGACCCATGAGCCGCTGCGGGACAATGA
CTCAGACCTCATCTTGAACGAAGGAGACCTGACGCTGACC
TACGGCGACACCGCCATCACAGCCAACGGAGCCTCATCCT
CCTCTGGTCCCGAAGGGTCGGCTGGGATCTGGGGCCTGAA
TGGCAAACGCAGCGACAGCACGTCAGAAGACGCTCTGGAG
AGAGAACTGGACACGCGTGAACATGAGCTGTTGAGCCGCG
GCACACGTCTGGTTTTCCCCATCGAGGACCACGCTTGAAC
TCACCACCCATTCCTCAAACACCCCGCACTCCATACCTCC
TCTCATATTGCACACCGCTCCATCCGACCATCCACAAACA
TCTCAAGACGGGGGGCTGAAATTTCAAGGAAACGGATGGG
TTTGTGCTCTAGATGAGTTTGTTTACCAGAATGGAGGTGT
CGAAGCTGTGGTAGGTTGAGTTTCTCCTCATGGAAATGTG
GAGGAAAAGGAAAGCTTTGGAATAAGCTTTCGTTTATGAT
CATTAAATGACACTGACACATTCAGACATTCACACACGCA
GCATTTATCATACATTACGCCATTATTACTTTGTTTAGCA
TTGCTGCTACAAACCGGAAATATGACTGAGCCAGTTTTTC
TCTTGAAAAATTCAGGTTTTTTATGTATGAGCAGTCAGTA
TTATTAATCATTTGCATTTAAATGCTCCTCTTCGCCGTCA
GGCAAATGAGCAAGCAGCTCATCATATCTGTAAATACGCC
AGACTGTACGTGGTGGTGGTGTTCGGTAAAATCCCTCGAA
CACAATGGGATCATTGTTTGATATGCGTGCATGTTCATCT
CATGACTGCATACAGGATCCTTGTAATACTCAGCTCCAAG
TGAGTTGTGGTTTACATTTCCTCTTGATATCTTGGTTGTC
AACACCAACTTGATGTAAATATGAATGTTGATCTGCACAG
TTGTGGGATTTCTTTCCTTTTTATTCGATAAAACAGCTGG
ATGCAACCGGAGTGTATAAACCATGCACTTTAGCTGCAGT
TGAGCTGCAGTCCTTGCATGTTTTGCTTTATTATATTGGA
TTATTAACCACTTGCACAGTCTGAAATTGTGACGTGAGAT
GATCGAAGAAGGTTTTTAGTGAATGCGTGTGTGTGTGTGG
CTTGTCTTTTGAGCCTCTTCACATGCAGATCTTGTAGGAG
TTGCTGCTATATGGCAACTTAACGATTCCGAAATCTGAAA
CATTTGGCATGACGTTGACCCGGCTGTTGAGTCTTTTCAT
AGAGTAAACAGATTCCATCAACCGCCAATGCAGATTCTTT
CTATCCTCTGAGTCTAGAATTGAATTATGCTTGCTGTTAA
TGAATGCAAGTTTAAAGTCCGAACATTTGGTTAATAACTA
ACTCAGATGTTTGAAATAAGACTTCATTCCACTTGATGAA
CTAACCTTGGACTCCTTCGATTTAATAGCCTTTTACGACT
GTCTCAATAGTCCGTGCCTGTCTGTCGTTTGCTTTTTAAG
CTGTGAAAAGATGCCTCACCTTCAATGTCATCCACAGTAT
CTAGTTCAAAACCTAAATGTGAATTGAGATTTGCACTAAT
GAATGGAGATTTGGCTAGATAATGAGCGTTATGGGCTTTG
TGGCAATTGAACAACCTTAAACTGGCTGTAGCAAAAGACT
AAGTCACTCTCATGAATGGCTCCTCCGACGTGTCTGAAAT
GGGTTTTTTCTTGAACATTCTATGGTGGACTTGTGTGTAC
CTTCAGGATATGTAACTCTTTCCTGTAGCATTCATCTTTT
ACTTGCTGTTCTGCATGTACGTATCTGCCATATAAACAAC
AACAAAGCATAATCAAGCTGCCATTTTTTAATGTCTATGA
TGCTAATTCCCCTCCTCACGCGAATCCCTATTATTTATAA
TAATATGATTAATATTATACATAAAGATGCATTCTTCTTG
TCAAATAAAGTGACAACTGTGGTATGCATTGTAGCTTAAC
CAATTGTACATTCATGAAAATAGCCAATGTATCAAAGCGG
GCTTCAGTAGCAATGCCTAAATAAGGTATTTGGTTTCTTT
TCTATGTCATTCGAAAATACTACTACTAATAATAATAATA
AAACAAGAAACTAGTGTTTACTACAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc9a7-202 Contained in:
OTHER slc9a7-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028217 (1)
  • Ensembl_Trans:ENSDART00000136585 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC096982 (1) 3825bp
    GenBank:EE685731 (1) 973bp
    GenBank:CN511223 (1) 830bp
    GenBank:DT068575 (1) 743bp
    GenBank:BF156353 (1) 580bp
    GenBank:EB773649 (1) 498bp
    GenBank:AW826698 (1) 493bp
    GenBank:CD591431 (1) 345bp
    GenBank:CD591380 (1) 344bp
    CITATIONS (2)