Transcript

rgs16-201

ID
ZDB-TSCRIPT-090929-10691
Name
rgs16-201
Previous Names
  • rgs16-001
  • zgc:110164-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028177 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028177|OTTDARG00000021981|ZDB-GENE-050417-393 rgs16|OTTDARP00000023046 rgs16-001 LG_ CR854912.18 Danio rerio protein_coding KNOWN, 1306 bp
CAGACACACTGCTGATAAATTTCTCTTAGAGAACACACTG
CGCAATGGATATTTATTTCCCTTCTGGCTTTACAATGTGC
AGAGAAATAACAGGGCTGTCAAACACTTGCTTAGAAAGGG
CCAAAAGATTAAAAGCATGCGTGGGTGGATTTCTGCAGAG
ACAGGACTTAAGCAGCCTATGTAAATATAGAAAACCAAGG
TTGACCTTGGAGGAATGTCTGATGTGGAAAGTGTCTCTCG
AGAAGCTTCTGTCGAGCAAACATGGACTGTATGCTTTCAG
AGCGTTCCTAGTGTCTGAGTTCAGTGAAGAAAACATCGCC
TTCTACTTGGCCTGCGAGGACTACAAAAACACAAAGTCTC
CAGCTAAGATGCCATCCAAAGCAAAGAGAATCTACGAAGA
GTTTATCGGAAGTGAAGCACCTAGAGAGGTTAACATTGAC
TACGAGACCCGAGATATTACTCAAGCCAACCTGCAAAGCC
CGACAGCATCCTGTTTCGACACAGCCCAGTACCGCATCTA
CATTCTCATGGAAAAAGACTGCTACCCACGATTCCTCCGC
TCTGCTTCATACCGAAATCTGCTCAACCAACTAACAATGA
AGAGTGCCAAGGGCCGAACCAGAAAGGCCATTGAGCTCAG
ACCTTCCAGAGAAGAAGAAGAAGAACCGAAATGAAAAAAA
ACAGATGCATTTTGGCTCTAGAATAGATGGAAGCTCAGGC
AAGAAAAGAAAGAGAGTGGTGTAGATCCTTAAAAAGGCGG
TTTGAGGTGAATGGCGCACCATGAAATGAATAGAAGCGTG
TGACGGAATCACTGCATTCCCAGATCCGCTAAAATTGTCC
AGCAGAGGGAAGAGCAGATCTGCTGGTGGAGAGAGATGAA
CTCAGCACAAAGAGAATGCTGACGGACTCTAGTGAACAAT
CATTGGACAGAAAAGCACACAGCATCTTTTGCTTTTTGTA
AAGATTAAATTTTTTTACAAAGATAAATGTGAATAATTAA
TGTGTTATTTATGCTTTTTAAAAACAAATAATAAATGACC
TTAAAGTATTGTGATGGAACTCTACCATGGCACAGTGATG
ATATATTTGATAAAAAAAATAAATTATATATACCATCAAA
GCCATCATGATAATGTTTTTAAATGGTTCAATAAAAACAT
AAGTGACAATCTGCAAAGAGGCACAACTTAATGTCAAAAG
TTTTTGTGCAACTATTTATTTGGGTGTTTTTTTACCTTCT
CTTTTAAAAGTATTTGTTAACTAAATGTTCAAATTAAAAT
GAATAAATTTTACATGAATGTGCTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations