ZFIN ID: ZDB-TSCRIPT-090929-10681
Transcript Name: wdr78-201
Previous Name: wdr78-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028166 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028166|OTTDARG00000021972|ZDB-GENE-050522-322 wdr78|OTTDARP00000023037 DKEY-218B7.4-001 LG_ BX088595.7 Danio rerio protein_coding NOVEL, 2932 bp
AGATGAAACACCATTACCGACTTGTCCTGCATAACTTCTA
GCCATCCACCCATCTGTCCTTACCGCTTTTAAAAGTCTAA
AACATGTCTAACACAACAGTCACACAGAAGAGACGCACTC
TGAAGGTCGCCAAGTCATCCAAAACACTAAATGTGTCATC
TGGTGTATTTCGTCCGAATCAAAGCACCACAAAGAGCATC
AACCCTTTATTCAGCGGGAAGAGCTTTGGTTCTACAGGTG
ACAGTAAGGTTGTGGATAAGATCTCAGCCCAAACTCCAAA
ACACACTGCAATGGTGGTTGATGAAAATGGGCAGGATGTC
ACTCCTCACCCATTATATAACCCAGATCCTGGGGTTCTAC
AATCTAAACAGGGAAAAGTATTCACTGCACTTGATACATC
TTTGACTACCATGACAGAATTTCCTTCGATAGCCTTTCAG
ACCACTAATGCAAGCCTTACAGGACCTTTTACGAGGTCTT
TTTTTGGGAGCGCTTCAGCATCCAGAATAAGCCAGACAGC
AGAATCAGTGACTGATGAAACTAAAGACTTGCTAGTGAAA
CAAGACTTGTCCAACAGTATTTCAGATATTCAGTCTCACA
GAGAGGAGCCGAAGGAGCAGCTCCGAGAGAATATTTTAGA
CAGTACAGCAAATTGTTACCTGAGTGAAACAGAGACCATC
TGGCTTCTGGACATTCCTGCAGTGTCTGTGTCGGTAGAAT
CAGAGGATGCTGAGGCAGTCAAGGAAAGGAACAATGCCTA
CACTGAACTGTGCAAAAACAGACAGGGAAATGATAAGTAT
GTGGAGCGCTCAATGCAAACATTCAGTGATGCATCAAAGA
CAAAAGAGGTCCAGTGTGATAGTATTACAATGGTGGACAA
AGCTGTCATGTGCACCGTCTGGGACATGTACGATTCATTC
AACAATATTAGTGATGTCAGTGCAAACACTGTGGTGTCAT
CTGAAAGACATGAGGCGACTATCCCAGAATCCTCCTCTGA
GGGTCACCTTGTGCACCCTAAGAGATCTAACCAGAGTCTG
TCTGTGGTCAGCACAGTTAGCACAGTCAGTGGCTCAAGCA
CTCATATTGAAAAGATGGCTTGTGTGCTTCCGCTGGATGA
AGAGCCAGACCTGCAGCTGATCTTACAGTCAGACAAACTT
AAGCAGGATCTGGCCTTGATGGAGCGAGTGGTTCTGGCTA
ATGTCTTCCAGCCCAAGCTTGCAGCATACAGACAGCTGCC
AATTATAGAAGACCCAGACTGTGTGCAGATGGTGATGGAG
GAGGAAAGCTGGACAGAGCAGTCCAAAAACTCTCATTGTC
CATTCCTTGAACGTCTCTGGGACTTCAGCTGTGAACTTAC
AATGGGGCGAAATGTTAGCTGTATGGTCTGGAACAAGAAA
AACCCAGATCTTCTTGCTGTGGGATATGGACAGGTTGAGT
TCAAAAATCCAAATTCTGGACTTGTGTGCTGCTGGTCTTT
GAAGAACCCTACGTGGCCTGATCGAGTCTTTCATTGTGAG
AGTGGAGTCACTGCACTGGATTTCTCAGCGAGTAATGCCA
ATCAGCTGGCAGTAGGCATGTATGATGGCACTATTGCCAT
CTATAACGTACAGACTTCAGAACAAACACCCATCACTGAC
AGCAGTGACTGTGCAAACCTGCACACAAGTCCAGTGTGGC
AGCTAACATGGATAGATCACGAGGATGGTCTGGCTGCAGA
TAAAGGGGAAATACTGGTCTCTGTGTCGTCTGATGGAAGA
ATCAGCAAATGGATCCACTACAAAAGCATGGAATGCGTTG
ACCTGATGAAGCTAAAGATACACGACCTGCAATGGAAACG
GCATATATCATCACTGACTCCAGGAATGTGTTTCGATTTC
CATCCTAATGATTCAAAGATCTACTTGGTTGGAACAGAGG
AAGGTCATATTCACAAGTGCTCTTCTTCATACAATGAGCA
GTACTTGGAAAGTTACAAGGCCCACAAACGTCCAGTCTAT
AAGGTAACATGGTCGCCATTCTGTTCAGACGTTTTCCTAA
GTTGTTCTTCAGATTGGACTATTCAATTGTGGAGGCAGGA
CCTCCAGATACCTGTGATGGGTTTCACCTCAGGCCAGAGG
GTTGTGTTTGATATCATGTGGTCTCCACACTGTGCTACTG
TCTTTGGTGCTGTCAGCGAGGGCAAGGTGGAGATCTGGGA
TCTGAGAGTCAGTAGTTTGGACCCGACATTAGTTAACTGG
ACGAGTCCAGGAGTGAATCCAACAGCTCTGTTGTTCAGTC
CAGAGACAGACTGTGTTCTGGTGGGAGACAGTGAGGGTCA
GGTCACGGTGTACAAGCTGAAAAACATCACAGCTGGGGGA
GGATCACAGGGGGAGACACTGGAGGATGTAATTCAGTCCA
CACTGTCCAGCCAACACTGACGAGCATTAAGAAAGACTGG
TAAAGGGTCATAGAAGGCTCATGCTGTTTGTTTTTACCTC
TCCATCATCATAATCTATATTCTCTGGCAGACTGAGAGAC
TCCATTTTACATAACAATGGGATTACAGCAAACATACCTG
TTTGAGCCTTATTGTGCATCCTAAATTATGGAAAGGTAAA
TTTATTTGTTGTTTTACAAGATTTTTTATGCTAAAAACAA
GTACATTACAATGTAAGTACTACTGTACAACAACATTACA
GGAACAGTTTACCCCAAAATTAAAATATATTCATTATTTA
CTCAAGTTTAATTCTCATATTTAGATGGAAACATGACTAT
TGGTTAGCATTCACAAAATTCTTTAAAATATGTTACTTTG
TGTTTTGGAAACAAGTGGAGTGAGAGCAAATGATGACATG
TTCATGAATATTCATCTATGGGTGAATAATCTAATTAATC
AAAATAGTGGTCTTGTGTTTCTAAATATTAAACTAGCACA
GATATACACTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wdr78-201 Contained in:
[BAC] DKEY-218B7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000028166 (1),  Ensembl_Trans:ENSDART00000065206 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095632 (1) 2933 nt
GenBank:CO926569 (1) 905 nt
GenBank:DV590880 (1) 807 nt
CITATIONS (2)