Transcript

ttc26-003

ID
ZDB-TSCRIPT-090929-10661
Name
ttc26-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028139 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028139|OTTDARG00000021957|ZDB-GENE-041212-41 ttc26|no_translation CH211-146L13.2-003 LG_ AL954384.11 Danio rerio protein_coding KNOWN, 844 bp
GAAAATGAATGAATTAATGAATTAATTAATTACATTTTTA
GTAGCATAAAACATTAAATATCATAATTATTTTGAAACAC
TATCAGTCTATTACTTTCTGTTGCAAAGAAAATCAAGGCA
ATCTGTTATTAGTAGTTTGACTGTCAATTGTTCAGACCAC
TGCCACATTTCGGTAGTTTCTACAGCTCTGATCCTGCTTG
TTTTGTTCCCTCAAAATTGTATTTTGAATTAGAATATTTC
AGCGATTATTTAATAAACAGTTGCTTTAGATATGTTATTA
AAATCAGTTTTGTGATCTTTTTTTCAGATGGGGCAGTTCT
ATTATGCAGCTAAAGCATTCGATGCTCTGGAGAGACTGGA
TCCAAACCCTGAGTACTGGGAGGGGAAGCGTGGAGCTTGT
GTCGGCATCTTCCAACTCATACTCGCAGGCCGAGAGTCTA
GAGAAATACTGAAAGAGGTTTTGCCGATGTTGAGGAGCAC
TGGTAACCCACAGGTTGAGTACATCATCCGCATCATGAAG
AAATGGGCCAAAGACAACAGAGTGGCTCTCTGATTGACTA
CATCGACTAGCATACCCAAACTGATTCTTCTGTAAATGAT
ATTTAAAAACGCTTTTGTATCTTATCTGTATGATTGCTTG
TTTGTATCAACAAAATATGTGGTGAGTAAAACTGTTCAGA
CTCAGAGAAACGTATACCTGTGGCCTGACTATATTTCTTA
TATTGTATTGTATATTTTTCGAATACTTGCGGTTGTCATA
AACAGAAAACTCTGCATTTACAATATTTCTCTGTGTGAAT
GTTTTCTGTCAGAGTGACAGCGTAACAAATAAAGTTTTTA
TCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations