Transcript

tmed4-202

ID
ZDB-TSCRIPT-090929-10631
Name
tmed4-202
Previous Names
  • tmed4-001
  • zgc:86755-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028102 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028102|OTTDARG00000021937|ZDB-GENE-040625-140 tmed4|OTTDARP00000022992 CH211-148L7.2-001 LG_ CT025912.10 Danio rerio protein_coding KNOWN, 1703 bp
GAAATCGATTGTCAGCCTTGGATTGAGTGAGGGATGATTT
GGATGGAGATGAAGACGTTGGTGTCCTGTGTCGGGTTTTT
GCTTTTATTTGTGTGGCTTTCTCCAAGCCAGGCCCTATAT
TTCCACATCGGGGAGACTGAAAAGAAATGTTTTATAGAAG
AAATACCCGACGAGACCATGGTTATCGGGAGATACAGAAC
TCAACTGTGGGACAAGCAGGCTGGCTCTTTTCTCCCATCC
ACCCCAGGTTTAGGCATGCATGTGGAAATCAAAGATCCTG
AAACCAAGGTTATCCTGTCCCGTCAGTATGGCTCTGATGG
TCGTTTTACCTTCACCTCACACACACCAGGAGAGCATCAA
ATCTGCCTCCACTCCAACTCCACCAAGATGGCACTGTTTG
CAGGTGGAAAACTGAGAGTCCACTTGGACATTCAGGTTGG
TGAACACACCAACAACTACCCAGAGATCGCAGCCAAAGAC
AAACTGACGGAGCTGCAGCTGAGGGTCCGACAGCTCCTGG
ACCAGGTGGAGCAGATCCAGAAAGAGCAGAACTACCAACG
GTACCGTGAGGAGCGTTTCCGCATGACGAGCGAGAGCACG
AACCAGCGTGTTTTGTGGTGGTCCATCGCTCAGACCGTCA
TCCTCATCATCACCGGCATCTGGCAAATGAAGCACCTCAA
GAGCTTCTTTGAGGCCAAAAAGCTGGTGTGAAAAGCAGAC
AACAGAACAAAGACAATGACCCAAGTAACATTCATAATCG
CTGTTTCGATTCTCAAGCATGGAAAAACTTCTCACTCCTT
CATTTCAGTATTTTTTTTTTTTTAATTCAGTTCGGTCTAA
CTTCAGCTTGAGCAGGTACATTTAGAGTTAATGATACCTA
TTTATCATTAAAGAAACATAATCAGAAATGCTTCATGTCA
CGAATGTCGTTCAAGTGTTCATATAATGAAGTAGTATGAT
ATAAAACAAATGTTAAACCTTTTCAGTGACGATCACTATG
GGTGCATGGAAACTACTGTTGACTAACGGTCGCATTACCC
ATAAATGTGAAGAATCAAGCCAGCTAATCATTTCTCACTA
TTTTCAATATGTATATATTGAGGACTTTGACAAATCTGTG
GCTTTGTTTATATGTTCTGGCCATTTTTTGGGATCAAAAC
ACCCTCAGATTGGTTTCAGGTTGAGATTAAATTTAGGTTT
TTGACAGGAAATGATTTAAGCTAATTGATTTTAGCGTACA
CTGTAGCTGTTTATCCACAATTTCGAGATTTTCTTAGTTT
TTGACTTACAAGATTTGATTTTAGTTGTTTATCAATACAT
TAGAGATTTTCTTTGTGGTTTAGAAAATTGATGTTGTTCT
TGATGTTTGGTTTGGTTTTCTATTTATTTTTCAGTGACAT
GACTTCGAATATTACTTCAATAGGTACATATGATGAGCAG
GAACGTCTGCAATTTAATCAAAAAGGTTGTTTTGTTTTCG
AGATTGTGACGTTTATAGGATCTTTGGAAATTTTTTGTAC
TGGCTTCTTACAAATACTGTTTATAAAACTGCTGGTTTGC
ATGACACTATGACAAAATCCTCCATGTAATGTGAAACGTT
GAAGGTTATTTCTATGTTAATGCAGCTCTGTATTGATGGG
TGTCATTTGAGCTTTGTAATAATAAACTATTTATGTGTGC
ACACTGTGCATGCACATACTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations