Community Action Needed: Please respond to the NIH RFI
Transcript

arhgap4a-201

ID
ZDB-TSCRIPT-090929-10608
Name
arhgap4a-201
Previous Names
  • arhgap4a-001
  • zgc:63672-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028078 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028078|OTTDARG00000021920|ZDB-GENE-040426-1229 arhgap4a|OTTDARP00000022973 DKEY-7I1.3-001 LG_ CR376748.8 Danio rerio protein_coding KNOWN, 2964 bp
TTTCTATCTCACGGGGTGTTTTGGTTTGGATAAGTAGTGA
TATAACAGGGTGGAAGAGGATTTGTTGAGAATGCCAAAGT
AAACACAAGCAGGAGTTATTAAGTCGAATTACAGCTTGTG
TGAGCGACGATGTCATCTCATGTCAAACTGAGGCGGGACA
GAGTGGGGACTGGAGACTATGACACACAGATTAAAGAGGT
GCGTTTACAGCTGGCGGAGCAGTTGAGGATATTTGACGGT
CAGGTGGAGCAGAAGACTCAGGTCTTTCAGGATATGGTCG
ACTATTTGCGCAGGCGAGGCGAGATCGAGGGGGAATATGC
TCGCTCACTGGACAAACTGTGTGACAAGTTCTCCTCTAGA
ACCAAAAAGAAGGAGTCCAGTCATCAGTCAGTTGTGAACT
GCTGGCAGGTGTTGTTGGCACAAACACGTCAGGAGAGCCG
AGATCACAGTATTTTGAGTGACAGCTACAGTAACATTCTG
CCTCAACAGCTTTCACACTGCATTGAACATGCCCAACGCC
TGGCCAAACGGAGCAGGGAAATCTGCACCCTGTTACAGGA
TGGGCTTTTGAAGGTCACCATAGAGCTTCATACAACCTTG
AAGACATATTACCAGTATTATACTGAGTTCCTGTCTGCAG
AAGGCAAACTGAAGGAGGCTGTCAAACTGGAGGAAAAGCA
AAAACAGAGTGCTTCTAAAAAGATGGAAAGACAAATAGAG
AAAAGGCAATGTAAAGTTCAAGAGATTCAGCTTAAGTGCA
CAAAAGCCCGGAATGATTACCTGCTCAACCTGGCGGCAGC
AAATGCGTGCATGAACAAATACTACCTTCAGGATCTTTCC
ACTCTCATAGATTGCTGTGATCTGGGTTACCATCAGTCCA
TATCCAAGGTGTTGCATTTTTACCTGAGCAGTCGCCAGTG
GGCTCAACAGAATTTGAGTACTGGGATGCGGCAGCTGGAA
ACAACGGTGTCCGAATTGAGCCAAAGCCAGGACAGAGACA
CTCTCATGCAGTTCAACAACTCAGCCTTTTGCCTGCCGCT
CCGTTTTCAATACCATCCCTATGAAGGCGACCAGGTGGTT
GAGGTGTCTGCAAAATGTGAGATGATGAGTGAGCTGGTGA
CTCGCGTCCAGCAGCTGCAGTCCAGACTCTCTTCAGTCAC
TCTGGAGGTTGAGGAGTCTGGCAAATTACTTCAGTCAGCT
CAATCTTCCATTCTGGAGAGTCTTGCTGAGATCGCTTTTG
GATCCACTCCTGACTTTCCCAGCAGCCCTTCATCACCAGA
GGGGAACAGCGATGTGTCTGCTAATAAGAACTTCACACTG
AAGCGTAGAGCCAGCCTTCCGGATGCTGAGAGCTTGTACT
TCACGAAAGTCAGAGACCATCTATGCAACAGCTCTTTAAG
ATCAAAATTGGAGGCTAAACATGACCTGCTAAAGGTTGCA
ATTCAGAAAGCTGAAAGTTTTGATGGTAACCATACCAGGA
CGCGCTCCAAAAGATCTGTGCGTCATAAAAAGAGTAACCC
TGGTTCACAGATCAACCAGAAGCTCTTTAATGGGGATCTG
CTTTCATACATTCAAGCATCAGGACAACTCATTCCTGCCG
TGGTGGAGAGCTGCATTCGCTTCATCAACCTCAATGGTTT
ACATCATGAAGGGTTGTTCAGAGTGCCTGGATCTCAGATG
GTGGTGAATCAGCTGAAGGATGCATTTGAGAAAGGTGATG
ATCCTCTTACTGATGAACGGTGTGACATGGACTCTGTGGC
TGGAGTGCTGAAGCTTTATTTTCGAGGCCTAGAGAAACCC
CTCTTTCCCGAGGACAGTTATGACCAGCTGATGGAATGTG
GACAAATAGATGATGAAACTAAAAAAGTAACACAGCTGAA
GCTCATCGTTTCCTCATATCCTCCATCACTCATCATTGTC
ATGAGATATCTCTTTGCATTCCTTCACCATGTCTCCCAGT
ACAGTGACGAGAACATGATGCAGCCCTATAACCTGGCTGT
GTGCTTTGGGCCCAGTCTGGTGAGAGGACCAAACAATGGT
GATGCGGCAGAGCTTCAGCGAATCAATGCCCTGGTCAAGA
GCATTATCATCCAACACGAGAGCATCTTCCCAAGCCAGAA
TGAATTACCTGGGCCAGTGTATGAAAAGTGCATGACACTT
GAAGAAGACGACTGTGAAGCTGTAGCAGAGGAAGGAGATG
GAGAATCAGAGCAGGTTCAAATAAAAGAACCAAAAGACGA
GCTGCAGGCACTGGCCCTGTTTGACTACATAGGCCGTTCT
TCAACTGAGCTGTCCTTCAAACACGGCGATCGCTTCATTG
TATACAGCAAAGCCTCCTCTGATTGGTGGAAAGGCGAAGT
GAATGGGTCAAAGGGTCTCATCCCAAATAAATATATCAGT
GTGCAGAGTGTGGATGGAGGCCAAGATCAGAAAGGGAAGG
AAACTCTGAAATCCAGCTGTGGCAGACACCAGACAGAGGA
AGAAGTGAAAGCTGAGAAAAGCACAAGATTAAAGGTCACG
ACTGACAAAGCCGGGGTCGGACCTAGTCAAGTCACCTCAG
GAAAAATTTGTTTGCAATTACCCACAGGACAATTTATACA
GCCAGGAAATTCTCCAGGTGCTCTGCGGAAAACATTAGAT
CCTCAAATGAGACGATCCACTACTGAAGGAGGAAGTAGGG
AGGAATGCTCAACAGATGTGGATAAGGAAGTGCATCACAT
GATGCACTCTGTGTTTAAGGAGCTTCTTAATCGCCAGTCT
TCCCCAGATCAAAATACATCCGCATCTTCTGAGATCACAT
CCACTGTCCAAACACCTTCAGTCAGAGGACTGGGATGGAA
AGGAAAAGGTTTATTTAGATCAGCTGACAATGCAGCTGAC
TGAAGAAATTAAAAAGAAAAAAGGGGAAACCCCAATAACC
ACAGTCTGAAACACAAGAAAATTAAAGTGAAACATCAACG
TGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations