ZFIN ID: ZDB-TSCRIPT-090929-10594
Transcript Name: ccdc102a-201
Previous Names: ccdc102a-001, zgc:77294-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028063 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028063|OTTDARG00000021914|ZDB-GENE-030131-4044 ccdc102a|OTTDARP00000022966 DKEY-107K2.1-001 LG_ BX323849.10 Danio rerio protein_coding KNOWN, 3031 bp
AAAAGCATCATCTTGACGTGCATCATGGATTCCTGATAAG
ATCTTCCTGACCGTAATCTTTTTCCCTGGACTCATCATTG
GCTCAGTGATGAACCACACACCCAGTCCCCACATGACCGA
GGCCGCCAAGTCCGGGGCAGGTTTGCTGTGCGGCTTGGGC
TTGGGCCCAGATCGGGTGCGCTCTCCAGACAGCCTGACCC
ATACGCCCAGCCCGTCAGGGGGAACGCCCAGCTCCAGCCC
TCCTCTGTTGCTCTCTCCAGGGCTGGGTTGCGATGGCATT
GGGGACTGGGAGAGCCGCGAGGAGCTGCGTCTGCGGGAGC
TGGAGGAGGCTCGGGCCCGGGCCGCTCAAATGGAGAAGAC
CATGCGCTGGTGGTCGGACTGTACAGCCAACTGGAGGGAA
AAGTGGAGTAAGGTACGGGCTGAACGTAACCGGGCACGGG
ATGAAGTCAGACAACTGAGGCAACGCTTGGACGCTCTTAC
CAAAGAGCTGACGGGTGCTCGACGGGAGCGCCAGGAGCTG
GCTGCGGAAAACGAACAGCTTCGTCTCGAGGCTCAAAGGG
TCCGAGCTGAACAGAGCTCCCCAGAGAATGCATCTAATGC
ACCAGAATCAAACTCCTCCACTGCCTCCACACATTCCAAC
CAGCCAAGAGAAGCAGAGATTAAGCAGGACAACCAGGATG
AGGAGGGTGTGAGAGATGGGCCTGGCTCTCCAGAGCAGGA
ACCTGTGAGAGACATAGGCACTGACAAACTATACAAGCAG
AAGGAGATGGAGTTGTTGGAGGCTCTTCTCAGGGCAAAGT
CAGAGGCTCCAGACTCGTGGGACGGTCGCAGTGCCAGTAG
CTTGCGCTCTGCCCTCAGCCGGCAGGACAGGAACAGACTG
CTGTGGGAGGATCTGGCTGCCCTGGAGGAGGACACCAGCA
AGCTCAACGCTCTCCAACTACGCCTGGATGAATCCCAGAA
AGTCCTGCTAAAAGAACGAGAAGATAAACATGCGCTTATT
AAAAACATTGAGAAGCTGGAGGCAGAGCTGAGCCAGTGGA
AACTCAAATATGAGGAGCTGAACAAGAGCAAGCAAGAGGC
CTTGAAACAGCTGAACCTGTTGAAGGAGGTGCATCAAGAT
GAACTTGGCCGCATGTCTGAAGACCTGGAGGATGAGTTGG
GTGCCCGCACCAACATGGACAAGAAACTAGCAGAGCTTCG
TACAGAGATGGAGCGTCTGCAGGTGGAGAATGCAGCAGAG
TGGGGTCGTCGGGAGCGTCTGGAGACGGAAAAGCTGGCTC
TGGAGAGGGAAAACAAAAAGCTGCGCACCCAGATGGAAGA
CCTGGAGGAGCAGCTGGCACGCAAGCGCAGGCAGGCCGCC
AGCGCCCTGGACACCGACCTCAAGACCATCCAGAGTGAGC
TGTTTGAGAGGAACAAGGAATTGGCAGATTTGCGGCACGT
TCACTCCAAGGTGAAGAAGCAGTACCAGGAAAAGATGGCC
GAGCTCACACATGCTAACCGGCGTGTAGAGCAGCATGAGG
CAGAAGTGAAGAAGCTGCGGCTCAGGGTGGAGGAGCTGAA
GAAAGAGCTGGGCCAGGCTGAAGATGAGTTGGATGAGGCC
CATAATCAGACCAGAAAGCTACAACGATCCCTGGATGAGC
AGGTGGAGCAATCCGAGAATCTACAAGTTCAGCTGGAACA
CCTACAATCCAGGCTAAGGCGTCAGCAGAACCCTGGCCTC
TTTGGCAAAATGAGGACATCAGCTTCATCACGTTTTGGCC
CTGAAGATGCAGACGGCCCTCCTAGCGACCCTGATGAAGA
TGAGGAAGAAGAACTGCAGCTCCAAATCCCCTGAACCCTT
CACTGCAGACCTGGGAATGACTGAAGACTCACCGATCTCA
CTCGAGCATTTCACCTTCCCCTTCATTTCATCTCTCAGCG
AAATCTAGAAGAGGACTTCACGACCCTCAGCAGACAGATA
AACACAATCCTTTTTCAGTAGCCTATAATAAATGTGTGCC
AGGGCCAAAGTACTGTCTGAAGCCTAAGAAAAACATTGCT
GGTTCTAGTCCAAGTTGGCACATAGGTTATTGATAGACAA
ATATCAGACCCATTTATTTGACTTTTGAGGGTCCATTTGA
AGCCTAGTGATTCCTATTATTCACATAAGCAGACACATGT
GCTGGCACACATTGTAAACGCATTAGAGCGTCCTCAAACT
TTCAGACATCAAAACCATCTTGAAACATTACATTTCATTT
TAATCCCCCATCTGACCTCTAAAAGAAGCTGTTTATTCAC
ACAGTTCTTCTTCATCAACCGTTTACATGCTCATTTCCCA
ACTTTATTCCTCATCACCTGGATTTTGATTTATTCTTGTC
ACCCATTCATTTCCACCGTTCCCATTTTACTCTTCCTATT
CATTTTGATTTTCTATTTAATCTTTCGCCAGCCCTCCCAC
CCACCCCCATCCCTCAACAGCAACTCTCACATCAATATTC
AAAACAACCCATTCAGAACATGATGATTATGTTCCTTGTG
TCTGGGGAACATTTCATTTCTGCTGTGTTGTTACTGAAGA
GGCAGGCGAGCGCTTTGGTTTTTGTTCTCGCCAGTATTCC
TGCGTTAGTTGTCCCAAAGTTTTTTCTTGGTGACTATATT
AATGTGTTTCGGTCTTGTTTTATATAGGAAGGAAGGGAGG
GGGTGGGGGATCGTGGGTAGTTTGTAAACGAGTCTGTTGG
ATTCTTCTTAAATACATACAAGCATAATTGCTTCGCCCTT
TTGCGTTCAACCTATAGAAAGGTGGCTGGTGCATGAGGGA
ATGTTTTAACAAATGGTCTGTTGATTTTAAAGAGATTTTT
AAGCAATATAATACTGTATACGTCTGCAATGGGGACCAAT
CTTGACTCATCTTTTACTTGGACATTTGTATGGTCATATT
AAAGTATTTATCAGATGTTTGTTTTTTACCTAAGTGGCCT
GTATTGCAGTATTTTGTATTTGTTTGTGTTTGTATTTTAT
CTCTATAAATGTTAAATGTATATACAGTAAA

ccdc102a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccdc102a-002 (1) 813
mRNA ccdc102a-201 3156
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccdc102a-201 Contained in:
OTHER ccdc102a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028063 (1)
  • Ensembl_Trans:ENSDART00000011324 (1)
  • PROTEIN PRODUCTS
  • VEGAPROT:OTTDARP00000022966 (1)
  • ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)