Transcript

ube2j1-201

ID
ZDB-TSCRIPT-090929-1058
Name
ube2j1-201
Previous Names
  • ube2j1-001
  • zgc:63554-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007852 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007852|OTTDARG00000006982|ZDB-GENE-040426-2853 ube2j1|OTTDARP00000006948 ube2j1-001 LG_ BX248418.16 Danio rerio protein_coding KNOWN, 2891 bp
GACATCTGAGACATTTCATCTCGAAAGTGTGTAAAAACAC
ACACACACCGCGCGCGCTGCCACGTCAGGGTTACAGCTCT
AGATAAACACCTGGCAGAGCTCACACAACACACACTCGGC
GGATAAACACACACTCACAGGAGCGCAGATCAGCCGAGCG
CCGGATTATTGAGCATCATGGAGAGCAAATACAACCTGAA
GAGTCCAGCTGTGAAGAGGCTGATGAAGGAGGCGGCAGAG
CTTCGTGACCCCACAGAACATTATCACGCTCAGCCACTGG
AGGATAACCTGTTCGAGTGGCACTTCTCCGTTCGAGGACC
TCCAGACTCTGATTTCGATGGAGGAGTTTATCACGGCCGG
ATCGTTCTTCCTCCTGAATACCCCATGAAGCCCCCCAGCA
TCATACTGCTCACTCCCAACGGAAGGTTTGAAGTGGGGAA
GAAGATCTGTCTGAGTATTTCTGGTCACCATCCGGAGACG
TGGCAGCCATCTTGGAGCATCCGGACTGCTTTAATAGCGA
TCATAGGATTCATGCCGACTAAAGGAGAAGGAGCGATCGG
ATCTCTGGACTACACTCCTGAGGAGAGAAAAGCTCTCGCC
AAAAAGTCTCAGGATTTCTGCTGTGAGGCGTGCAGCAGCT
GTATGCGCTCGGCTCTGCTTCCTCTCTCTCCTGACAGTGA
CCTTCGACCCGCTGACCCTCAGAGACTGGCACAGCAGATC
AACTTCAAGGCTGAATCCAGCTCCTCCGCTGCAGACAGTA
GCAGCTCCTCATCAGCAGCAGCCGAAGTGTTTTCCAACAC
CAGCGAGAGCTCTGAGACTGCAGACCAAGATACAGAGGAC
ACGTCTGCAGCTGAGCAGACCGAATCCTCATCTGTGGCTC
CTCAGACATCAGCCGAGGATCCATCAGTTTCAGCAGCTCC
CAGTCCTCGTCAGCGCCGCTCCCAGAACCAGTCCCCTAGA
TCCCCCGTGTTCCCGGCGTCCCCTGCACCCCCGCACCTCC
CTCAAGACAGCAGTCGCACCGGCTCGGCCATCCTCATCGT
GCTGCTCACGCTGGCTCTGGCCGCGCTCATCTTCCGCAGG
ATCTATTTAGCGCACGAGTACAAGTTTGACTACGAGCTGT
GAACTCTTTCCCAAGCGGCGTTCGCTCTGGCACCAGAACG
GGACGCCTGTTTCCTACATTCAACTCTTCATAAATGTTTT
CACCAATCAAAAGGGGTGAATATTAGTACGCTAGGTAACA
TGTCAGGTCTTGATTTCACCCCGAAAACGTACCAAATTTA
CAAAATGATAGTTTTTTATTTTAATATTTTGTTTTGGTCC
CACTTTCTATTAAGTGGCCTTAACTAATATGTACTTGCAC
TGAAGTGATTCATTTATTACATTATACCTGTGTAAATATG
TGTTTTTACTTTGTACTCATGCTTGATTAAATACCTGAAT
GGGATAATATCTGGGTCACTTTATTTTGATGGTCAGTTTG
TTAAATTTAAGCTACATGCCGACTAATTCTCATCAGATTA
TAAGTAGACACAAGACACGTACCTGCAAAGTTTCCTATTA
GTCTGTTGAAGGAGCAGTATCAGCAGATATTAAGCAGACA
GTCTACTAATACTCAAATGGACCATCAAAATAAAGTGTTA
CCAACATCTTTATTTAATTTCTTTAAGTGCACTATTGAGG
ATCCGGAACACCTTTAACCTCTCCATACAACCAAACCTGT
CCCTAACCCGACCCGTATCCCACCCTAAGAGTACCACAAC
ATGAATAATACGTTATGAACACAGTAAGTACATTGTATTT
ATATTTTGATGCAAGTACAGAGTAGTTAAGGCTGCCTAAT
ATAAAGTGGGACCTTTTTTTTGTTGTTGTTGCTCTGTTAA
AACTGACAGAGCTATCACTGTCTGGTGAGGTCACAGTTGA
ACTGTTTTAACTGTAAAGTATTTATGCATTGTGGGATGAC
AAAAACTGCCTTTTAAATTGAAGATTTTATTGTTTAAAAC
AGCTGGGGAGATCGATAACTCTAATCAGACTCTCTGGTAT
TTAAAGGTGTGTTCATAAGCTCTTATGCATACGTGAAGAG
TCATTCACGCAGTTGTCGCCAATTTAAACGGTGACATTGT
TTGAGATGTCTTTGTTACGACACCTTGATATCACCAATAC
TTGTCATAAACCTGTCATAAACATGATTGTCATTATAACC
GTAATGAATGCCAACTTCAGTGGTACTAATTGAATTTGTC
ATTAAAATTAACTATTAACACTGACAGAGTATTGATTTTT
AACGACAATCTTCAGTTATTAGAGTTATATTAATTTTATT
CTACTAAATAAAGTGATCAGATAAAGATTAATGATGCAGT
TAAAATTGGTTTGTGATAATCATGTTTATGACAGGTTTAT
GACATTATATTGTCTTGGTTAAATCAAGCTGTCATAACAA
AGGCATCTCAGTCAATGTCAACTTGGCATTTTAAACACAA
CTGAGCGAATGTCACTCAGTAACAGTTGTCATAAACATGC
ATAAAATCTCATTAATATTCCTGATTTGTGGAGTCATGAT
TATTAACGCATCATGACGGTCTTATGAACACCCTTTTCAA
AAAAAGTGATATCAATCCTTCTCAAGTATCTGGGTAATAT
TCCTGTTTTCATCATGCAGACTATCATTAACACAATTACA
TTTCAATGTGGGGTGTAACATGAGCGAGACATGCGGTTTC
CTTGCAGATCCTGTGCTATATTGCAGATTATTATATAGTG
TTTGAGTCTGCTGTTTATCACATTATAGTGTGTGGAAATG
TACAGGTTTGATCTTAAACTGAAACTAATCCTAACCTGAG
AACATGCATACTGCTTCTGATATCGCCCAAATAAATATTT
ATATATGCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations