Transcript

zgc:136864-002

ID
ZDB-TSCRIPT-090929-10565
Name
zgc:136864-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028034 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028034|OTTDARG00000021895|ZDB-GENE-060331-129 zgc:136864|no_translation CH211-196H16.2-002 LG_none AL929150.13,FQ323126.3 Danio rerio protein_coding KNOWN, 503 bp
GAGGTAAAAACATCGTATTACTTTAAAATATGAGTATTTT
AAACGCTAAAAACATACAGTGTAAAAAAAGTAGCGTGTTT
GTTCATGTGTAAATGCGCATGCGCACTCAATATCTGTTTA
CTTTTTATTCCAGGAAGGATAATCGCTCCCAAAAAAGCTC
AAGTGGTCCAACAACAGAAGCTAAAGAAGGGTTTGGAGGT
GGCCATCAGGAACAAGATTGAACATGAAGTCACACAGAAG
GCCAGCACGTCCCTGCATAAGAAACTGAGTGTGTTGAAAA
CTCCAGCACAGAAAAGCGGGACAGCAGGAGCCCCTAAACC
TGCAGCTGGACCCTCTAAATGAAGCAAAGTAATCAGGAGC
GTGTCATCTTTCGTGCAGCCGCTAGGCGGAGCTCCCCGCG
CGGGAAAAGACTGACGATCGACACTGTTTGAACGGATAGT
TAAAACACCCCTACAGTTAGCCATAATCTTTGCTATTTTA
ACTTAATAAAATGATAAAATAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations