ZFIN ID: ZDB-TSCRIPT-090929-10533
Transcript Name: tmed1a-201
Previous Names: tmed1-001, tmed1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028000 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028000|OTTDARG00000021872|ZDB-GENE-040801-229 tmed1a|OTTDARP00000022912 tmed1a-001 LG_ BX088529.6 Danio rerio protein_coding KNOWN, 1370 bp
ATTAAAACATGATGAGTTGAAAAGCTTCCTGTAGCTTTGG
AAAGCTTCTCGACGCAACAAACGCGTACAACACTTTGACG
TCGGAACACAGTTAACAAATCAACGACAGTGTTTGCGCGT
TTTACGCGACGCAGGAAAACTGCAACGCGTCAGTTATTAA
CGAAGCTATCAAACTTCACGCGCGGCTGTTTGTCATGTAG
GTTCACGGGAGTCCAGACAATGCGCTCGCGGTGAAGTTTG
GCAATGATAGAGTCCTGGTGAGGTCGCGTCGCTTGCAGTG
CACACTGCCTGTTTGATACAGCTGCTTAAGTGTGTTAGGA
AGAGCAAAAGTCATGGACGAGACGCGTCTCGCGGTTTGTT
TTCTATCCTTCCTGACGCTCTGTCTGGATTTGGGATTCAC
TTTCGGACAGAATAAAGACACCGAGTTCACCTTCCTTCTG
CCTGCTGGAGCAACCGAGTGCTTCTTCCAGACGGCCACCA
AGAACAGCAGCATGGAAGTGGAGTACCAGGTGATCGCAGG
CTCAGGACTGGACGTGGGCTTCACTCTGATCTCCCCCCGG
GGGTACAGACTGGTCTCAGACTTCAGAAAATCTGACGGCA
TCCACACTGTTGACTCCACTGAGGAGGGCGACTACCGGAT
CTGCTTTGACAACAGCTTCAGCCGTATATCGGAGAAGATG
GTGTATGTGGAGGTGATCATGGATGGACCAGAAGGAGAGG
ATGAGGATGATGAAGACTGGGCTGCTTTGGCTGAACCTGA
GGACTCACTGGAGTACAAACTGGAGGATATCAGGGACTCG
ATGGACGCAGTGCACAAGAGCCTGGAGCGAAGCCGTCAGC
TTCAGACGACACTGCGGGCGTTCGAGGCTCGTGACCGATA
CCTGCTGGAGGATAACCTTTGGCGCGTCTCCTTCTGGTCC
TGCGCCAGTCTGCTGGTGATGATCAGTGTGGCCCTCACAC
AGGTCTACACGTTACGCAGATTATTCAACGACAAACACAA
AGTTTGCACATAGCAGAGTTGAACACTGTAACACCCAATG
CACTGCTTATGCCAAATATTAAAAGGATGGATTCTGGACA
CTCTCAGGTCCTAACTAAACACTCTATAAAACTGTGAGGT
CTTTAGAGATATCAGTGAAATCTTGGAGTATTAGTTAAAC
TTGTTTTAGTTTTAATAAGAAGAGTATGTAGCAGCAAACA
CTGGTGAACACAACATTTATTTGAATCACTGTACAGACAT
TTGAATGTGAATCTAATTTGGATTTGACTTTTAAAACACT
GCAGTTAAAATCATTTATGTGACTTAATAACATTTGCTAG
TAGATTCCTTATAGGATTATGTGGTATAAATAAAAAAAGA
AATAATGCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmed1a-201 Contained in:
[BAC] CH211-286H12 (1)

Genome Resources: Vega_Trans:OTTDART00000028000 (1),  Ensembl_Trans:ENSDART00000047071 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC078377 (1) 1190 nt
GenBank:CK866502 (1) 834 nt
CITATIONS (2)