header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10523
Transcript Name: psmg3-201
Previous Name: psmg3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027990 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027990|OTTDARG00000021863|ZDB-GENE-040718-262 psmg3|OTTDARP00000022903 psmg3-001 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 815 bp
GACCGTTCCTCTCTGTCTCTCTCCTCCTCTCGTTCAACAT
CTTTCCCCTTTGTCATTGCGTATGCGTAGAAGAAGATCCC
CCACGTTTCAGTGTTCGCCGAGGGATGTTCATAAACTGAA
TTCCATCGACTTAACAGGATAGTTTACTAGCCCCCGTCAA
TAAGTTACAGGTGAAATTAAATAATGGCCCCTCAACCAGT
CATCCGATCAAAACAGGCAGAAAAAACAATAAACGGAAAC
CAAACTCAAGTTGTTTGCACGGAATTCAGCAACTACATAT
TTATCGTTCTGACACAGTATGGTAAAATTGGAACGCTCGT
GTCTATAACGCCTGACACGAGGTCCGGTGACATCAGTGTA
CCAATGTACACTAGCAAAGTCCTGCTGGGGAAAGATGAGC
CTCTTACACACGTCTACGCCAAGAATGTTGCAACGTTTGT
CTCACAGGAATCAGGCAACCGACCAATCCTGTTGGGCCTT
TCACTGAAAGACAACAGTGCTGAAACTATGAAAACTGTTA
AAGATATGATCAAAAGCTGCCAGGTTTGGTAAACAGAAGG
TCACATGGCGAGCACACTATTTTTGTTTTGGAGTATCTTT
GCGATTTATACATCATAAATCTTTACTTGTCTTCGGTGAG
TTTACAGAATGCTTGAGCAGATGGTGATCTTAAGTGCTCA
TGCTATACTTGAACAGTACTCAGCACTTGATACTTAATAT
AAAAAGTGAGAGAATTGTTCAGTTTCACTTCTATTTTTCC
AGATAATAATGGATGTCTTTAAGTTGTCACAAGAATAAAT
TTATATTTTCTTATC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
psmg3-201 Contained in:
[BAC] DKEY-43P13 (1) (order this)

OTHER psmg3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027990 (1)
  • Ensembl_Trans:ENSDART00000169820 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076368 (1) 775 bp
    GenBank:CT668611 (1) 744 bp
    GenBank:BM026189 (1) 541 bp
    CITATIONS (2)