Transcript

tmem184a-201

ID
ZDB-TSCRIPT-090929-10512
Name
tmem184a-201
Previous Names
  • tmem184a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027979 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027979|OTTDARG00000021855|ZDB-GENE-040426-2925 tmem184a|OTTDARP00000022893 tmem184a-001 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 2965 bp
TGCTGTTGTGTTGTTGCGAAGTACGTACACCTGCCCTAAT
TTGAAACCGACTTGTGAGCTTCTTTTGTGTGGAATCGCGA
AAAGGCTTTTGGAAAAACCGATCCTGTACACCTTCGCTTT
GGGATTTTCATCACCATCCGCCAGGTCATCTGTTTCCGTC
TGTTTCCATCGAGCTGAGTGACGTCCGTCAGACCTGTCTG
TCAATAGTTCAACGAGGAAGTGTCGTCGCGGGCCGACTCT
ACCTATGGCTAACTTGCATGTCGTTTTCTGATACTTGCAT
AGAGTAAAATATATGCAATATATGAAGTATTTTAGTCCCA
CAGCGATGTTTAGAGTAAAACTGACGTTTATTTGACTTTT
AAGCCATTTACGTTTGATCACAATCATCTCTTCACGTGTT
GATACAGTATCAGGATGAATGAAACTACTCTAAGAATTCT
GTCAGCGAGTTCAGATAAAAACATGGACAATGTTCCTTTG
CCTTCATACTCCCTGCTGTCAAATAACACAGACTTTTTGA
ACAAGACCGTGATCAGGTCTGCTAATGGAACTGAAGTTGT
GGCAGACGACCAGATCTTCCTTAGCACGGCCACAGCTCAA
GCCCTATCAGGCATTTTTGTATGGTCCGCGCTCATCCTCA
CCTGTCATCAGATCTACTTGCACCTGAGGTCGTACACGGT
GCCAAACGAGCAGCGCTACATCATCCGCATCCTCTTCATC
GTCCCCATCTATGCCTTCGACTCATGGCTCAGCCTGCTGT
TCATCACTAATGACCAGTATTATGTGTATTTCGACTCTGT
TCGTGACTGCTATGAAGCATTTGTGATATACAACTTCTTG
AGTCTGTCTTTTGAGTACCTTGGAGGAGAAAGTGCCATCA
TGTCCGAAATAAGAGGAAAGCCCATTCAGTCTAGTTGCCT
GTATGGCACATGCTGTTTGGTAGGGATGAGCTACTCTATT
GGCTTCCTGAGATTCTGCAAGCAGGCCACACTTCAGTTCT
GCGTCGTCAAACCCATCATGGCTGTCATCACCATCCTTCT
GCAGGCGTTTGGCAAATATCACGATGGAGATTTTAATGTA
ACAGGAGGTTACCTGTACATCACCATCATCTACAACTTCT
CTGTCAGTTTGGCTCTCTATGCCCTCTTTCTCTTCTACTT
CGCCACCAGTGACCTTCTGAGACCTTTTGAGCCTGTGCTC
AAGTTCCTCACCATCAAATCAGTCATCTTCCTCTCGTTTT
GGCAAGGCATGGTTTTGGCTATTCTGGAACGCTGTGGTGT
GATCCCAGAAGCTCAGTTCATTGATGGTCATGAGGTTGGT
GCTGGAACAGTAGCAGCCGGCTGGCAGAACTTCATCATCT
GCATCGAAATGTTCTTCGCCTCCATCGCCCTCCGCTACGC
CTTCACCTCCAGCGTGTACCGCGAGAAGAAAAACGAAGCA
CCAGAAAATGTGGCACCTATGCACAGCATATCCAGTGGCT
TGAAGGAGACCATTAACCCTGGAGACATGGTTCAGGATGC
AATCCACAACTTCTCTCCCGCTTACCAGCAGTACACCCAG
CAGTCCACGCAGGAAGTGGTGCAGCCCAATGCAAACGGCA
AACCGGGAATCAGCACCTCCAAGAGCACCAAAAAATCAGA
CAAAGTGATGCTGATCGACACAGATGATGAGTTCTAGCTT
GAATCTGTCCTGTCCCTTCTATTTATTGAATCTGAAACTA
ATTTAACTCTTTCTAACTTTAATACCAATGCTAATCATGT
AAATCAGCTCATGATTTGTTTTTATATATCTATATATGAA
GAGATCTTAAAAAAGGGATCTGAGCACACCAGGAATGAAA
GGAGATGGTGTCAGGAAGGGCTTGTTTTGTTTTCTTCACT
GTAGTCCGGAGCTCATCCCGTTGCGGCAGTTGATCTCTGT
GATGAAGAGTCCCACTTTTCTACCAAGCCAATGTCTTATA
AACATGAGGGTGTTTGGATGGAAAGAATGAGGGAGCATCT
GTCCGTTTGAAGTATTTGCTCAGCATCCCTCTGCTGGTTC
CCAGGACAAATTGAACGGCTCCCAAAGACGCCCTGGCTTT
GGAGATGGCACTTCAAACATTTGTATGTGACTCTTTGAAA
CCTCCATATCAATCATACCACACGGACAAAGTGTGGGACT
GAGCACTGGCCCCCCCCTGTTTGATTCGGAGGTTCATTAA
TTTTCACACCAGGTCTTCAAAGAGAATATGATCTGATGCC
GAAAAAAAGGAGAGTCTCCGCCACTGTTGCGTATTTTAAT
TGCAGATCATTCGTATTCATCCAATGTTTGGTTGGGTAAA
GCTTTAACCTATGATGTTTTAAGTGTTTAACAAAACAGGC
GGTTACCTGGGCTAATTTGTTGACGTTAAACGATGTTGTT
TAGCTCTCCGTTCAAGAGCGATTCGTTCCTTTTATGGTTT
ACATGTGTAAACAGTCCAAGATGAAATACTTCAGGCGTCA
TGAAAAAGCCATTGAAAATGTTTATTTACCGCTTGTTACC
ACAAAGTGAACTCCTGATCACTTTCCAAACAGAATTTGAC
GTCTTTGAAACCCTGCCTTTTGAAGTTTCTGAGCACACCG
CTTGTTATGTCTGAATACGAAATAGTTTTTAAATGTTAGC
CGGTATGTTTGTTAATATGCATTGATCTTGTTTTGTTAAT
TATTTCTCGAAAATATACAGACTTGAGAATGTAATAAGTG
TTCTCTTTACTTTATAGACAAAATAAGGGTGCCTATTTTG
TCTGTAAAATAGCCATTGAACGAATGTCGGGAGGCAGCAT
TATACGAGTATAACTTGTGCCAATGATTGCTGCCTTATAT
ATGTGGATGAAGGAAGTTGTGTTTATATATTGTGTGATTC
AGAGTATGATATCTTATAAAGAAGCTACCTGTACAGTTGG
TTTTACAAATCTGTTCTCATAGGAAATAAATGAATGAGAG
TGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations