ZFIN ID: ZDB-TSCRIPT-090929-10512
Transcript Name: tmem184a-201
Previous Name: tmem184a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027979 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027979|OTTDARG00000021855|ZDB-GENE-040426-2925 tmem184a|OTTDARP00000022893 tmem184a-001 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 2965 bp
TGCTGTTGTGTTGTTGCGAAGTACGTACACCTGCCCTAAT
TTGAAACCGACTTGTGAGCTTCTTTTGTGTGGAATCGCGA
AAAGGCTTTTGGAAAAACCGATCCTGTACACCTTCGCTTT
GGGATTTTCATCACCATCCGCCAGGTCATCTGTTTCCGTC
TGTTTCCATCGAGCTGAGTGACGTCCGTCAGACCTGTCTG
TCAATAGTTCAACGAGGAAGTGTCGTCGCGGGCCGACTCT
ACCTATGGCTAACTTGCATGTCGTTTTCTGATACTTGCAT
AGAGTAAAATATATGCAATATATGAAGTATTTTAGTCCCA
CAGCGATGTTTAGAGTAAAACTGACGTTTATTTGACTTTT
AAGCCATTTACGTTTGATCACAATCATCTCTTCACGTGTT
GATACAGTATCAGGATGAATGAAACTACTCTAAGAATTCT
GTCAGCGAGTTCAGATAAAAACATGGACAATGTTCCTTTG
CCTTCATACTCCCTGCTGTCAAATAACACAGACTTTTTGA
ACAAGACCGTGATCAGGTCTGCTAATGGAACTGAAGTTGT
GGCAGACGACCAGATCTTCCTTAGCACGGCCACAGCTCAA
GCCCTATCAGGCATTTTTGTATGGTCCGCGCTCATCCTCA
CCTGTCATCAGATCTACTTGCACCTGAGGTCGTACACGGT
GCCAAACGAGCAGCGCTACATCATCCGCATCCTCTTCATC
GTCCCCATCTATGCCTTCGACTCATGGCTCAGCCTGCTGT
TCATCACTAATGACCAGTATTATGTGTATTTCGACTCTGT
TCGTGACTGCTATGAAGCATTTGTGATATACAACTTCTTG
AGTCTGTCTTTTGAGTACCTTGGAGGAGAAAGTGCCATCA
TGTCCGAAATAAGAGGAAAGCCCATTCAGTCTAGTTGCCT
GTATGGCACATGCTGTTTGGTAGGGATGAGCTACTCTATT
GGCTTCCTGAGATTCTGCAAGCAGGCCACACTTCAGTTCT
GCGTCGTCAAACCCATCATGGCTGTCATCACCATCCTTCT
GCAGGCGTTTGGCAAATATCACGATGGAGATTTTAATGTA
ACAGGAGGTTACCTGTACATCACCATCATCTACAACTTCT
CTGTCAGTTTGGCTCTCTATGCCCTCTTTCTCTTCTACTT
CGCCACCAGTGACCTTCTGAGACCTTTTGAGCCTGTGCTC
AAGTTCCTCACCATCAAATCAGTCATCTTCCTCTCGTTTT
GGCAAGGCATGGTTTTGGCTATTCTGGAACGCTGTGGTGT
GATCCCAGAAGCTCAGTTCATTGATGGTCATGAGGTTGGT
GCTGGAACAGTAGCAGCCGGCTGGCAGAACTTCATCATCT
GCATCGAAATGTTCTTCGCCTCCATCGCCCTCCGCTACGC
CTTCACCTCCAGCGTGTACCGCGAGAAGAAAAACGAAGCA
CCAGAAAATGTGGCACCTATGCACAGCATATCCAGTGGCT
TGAAGGAGACCATTAACCCTGGAGACATGGTTCAGGATGC
AATCCACAACTTCTCTCCCGCTTACCAGCAGTACACCCAG
CAGTCCACGCAGGAAGTGGTGCAGCCCAATGCAAACGGCA
AACCGGGAATCAGCACCTCCAAGAGCACCAAAAAATCAGA
CAAAGTGATGCTGATCGACACAGATGATGAGTTCTAGCTT
GAATCTGTCCTGTCCCTTCTATTTATTGAATCTGAAACTA
ATTTAACTCTTTCTAACTTTAATACCAATGCTAATCATGT
AAATCAGCTCATGATTTGTTTTTATATATCTATATATGAA
GAGATCTTAAAAAAGGGATCTGAGCACACCAGGAATGAAA
GGAGATGGTGTCAGGAAGGGCTTGTTTTGTTTTCTTCACT
GTAGTCCGGAGCTCATCCCGTTGCGGCAGTTGATCTCTGT
GATGAAGAGTCCCACTTTTCTACCAAGCCAATGTCTTATA
AACATGAGGGTGTTTGGATGGAAAGAATGAGGGAGCATCT
GTCCGTTTGAAGTATTTGCTCAGCATCCCTCTGCTGGTTC
CCAGGACAAATTGAACGGCTCCCAAAGACGCCCTGGCTTT
GGAGATGGCACTTCAAACATTTGTATGTGACTCTTTGAAA
CCTCCATATCAATCATACCACACGGACAAAGTGTGGGACT
GAGCACTGGCCCCCCCCTGTTTGATTCGGAGGTTCATTAA
TTTTCACACCAGGTCTTCAAAGAGAATATGATCTGATGCC
GAAAAAAAGGAGAGTCTCCGCCACTGTTGCGTATTTTAAT
TGCAGATCATTCGTATTCATCCAATGTTTGGTTGGGTAAA
GCTTTAACCTATGATGTTTTAAGTGTTTAACAAAACAGGC
GGTTACCTGGGCTAATTTGTTGACGTTAAACGATGTTGTT
TAGCTCTCCGTTCAAGAGCGATTCGTTCCTTTTATGGTTT
ACATGTGTAAACAGTCCAAGATGAAATACTTCAGGCGTCA
TGAAAAAGCCATTGAAAATGTTTATTTACCGCTTGTTACC
ACAAAGTGAACTCCTGATCACTTTCCAAACAGAATTTGAC
GTCTTTGAAACCCTGCCTTTTGAAGTTTCTGAGCACACCG
CTTGTTATGTCTGAATACGAAATAGTTTTTAAATGTTAGC
CGGTATGTTTGTTAATATGCATTGATCTTGTTTTGTTAAT
TATTTCTCGAAAATATACAGACTTGAGAATGTAATAAGTG
TTCTCTTTACTTTATAGACAAAATAAGGGTGCCTATTTTG
TCTGTAAAATAGCCATTGAACGAATGTCGGGAGGCAGCAT
TATACGAGTATAACTTGTGCCAATGATTGCTGCCTTATAT
ATGTGGATGAAGGAAGTTGTGTTTATATATTGTGTGATTC
AGAGTATGATATCTTATAAAGAAGCTACCTGTACAGTTGG
TTTTACAAATCTGTTCTCATAGGAAATAAATGAATGAGAG
TGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem184a-201 Contained in:
OTHER tmem184a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027979 (1)
  • Ensembl_Trans:ENSDART00000168228 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC081639 (1) 2982bp
    GenBank:BC057539 (1) 2934bp
    GenBank:AW174268 (1) 774bp
    GenBank:BQ617255 (1) 693bp
    GenBank:BI867455 (1) 529bp
    GenBank:BQ616949 (1) 526bp
    GenBank:AW165076 (1) 517bp
    CITATIONS (2)