Transcript

actn3b-201

ID
ZDB-TSCRIPT-090929-10200
Name
actn3b-201
Previous Names
  • actn3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027653 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027653|OTTDARG00000021669|ZDB-GENE-030131-2040 actn3b|OTTDARP00000022648 actn3b-001 LG_ AL808019.6 Danio rerio protein_coding KNOWN, 4785 bp
GTGCTACTTTTGACCAGGATAGGAGCACTGGGCAGCAGAA
GTTCTGCTCGCACCTCCACACCGGCACCTCAGACGAGTGG
AGTCTGGCCTCTTCCTCCGCGGTCAACAGGATTTAGAGCT
CTAAAGCGCACATTACTTCTAATAATAAGGGTTAGAGGGA
TAGGTGTGAAAAGATGACGGCTGTTGTTGAGACGCAGATG
CAGTATAACAACACCTACATGATGTCTACTACGCAAGACT
ACATGATTCAGGAGGATGATTGGGACAGGGACCTGCTGCT
GGACCCTGCCTGGGAGAAACAGCAGAGGAAGACGTTCACG
GCGTGGTGTAATTCTCATCTGCGTAAAGCGGGAACTCAGA
TCGAGAACATTGAAGAGGATTTCAGGAATGGCCTCAAACT
CATGCTGCTGCTCGAGGTCATCTCAGGTGAGAGGCTGCCC
AAACCTGACAAAGGAAAGATGCGTTTCCACAAGATCGCCA
ACGTCAACAAGGCTCTGGATTTCATCTGTAGCAAAGGAGT
CAAACTGGTGTCCATCGGTGCTGAAGAGATTGTTGATGGT
AATGTGAAAATGACTCTGGGGATGATCTGGACCATCATCC
TGCGTTTCGCCATCCAGGACATCTCTGTGGAGGAGACGTC
TGCTAAAGAGGGTCTTCTGTTGTGGTGTCAGAGGAAGACT
GCCCCCTACAGGAACGTCAATGTACAGAACTTCCACATCA
GCTGGAAGGACGGCCTGGCTCTGTGCGCCCTCATCCACAG
ACACAGACCAGACCTCATCGACTACTCCAAACTCAGAAAG
GACGACCCCATTGGAAACCTGAACACTGCATTTGAGGTGG
CTGAGAAATACCTGGACATCCCCAAAATGCTGGACGCTGA
AGACATTGTCAACACTCCTAAACCTGACGAGAAAGCCATC
ATGACCTACGTGTCCTGCTTTTACCATGCTTTCGCTGGTG
CTGAACAGGCTGAGACGGCTGCTAACAGGATCTGCAAGGT
TCTAGCTGTGAACCAGGAGAATGAACGGCTGATGGAGGAG
TATGAGAAACTGGCCAGCGAGCTGCTGGAGTGGATCCGCC
GCACCATCCCCTGGCTGGAGAACCGCGCGGCGGAGCAGAC
CATGCGCGCCATGCAGCAGAAGCTGGAGGATTTCCGGGAC
TACAGGCGCGTTCACAAGCCTCCGCGCGTGCAGGAGAAAT
GCCAGCTGGAGATCAACTTCAACACCCTGCAGACCAAGCT
GCGCCTGAGCAACCGTCCCGCCTTCATGCCCTCCGAGGGG
AAGATGGTGTCGGACATCGCTAACGCTTGGAAAGGTCTGG
AGCAGGTGGAGAAGGGTTATGAGGAATGGCTGCTCACTGA
GATCCGCCGTCTGGAGAGACTCGATCATTTGGCTGAGAAG
TTTAAGCAGAAATGCTCCCTGCATGAGTCCTGGACCACAG
GAAAGGAGCACCTGCTGTCCCAGAAGGACTATGAGACGGC
CTCTCTGATGGAGATCCGGGCTCTGATGAGGAAACACGAG
GCGTTCGAGAGCGATCTGGCCGCTCATCAGGACCGCGTGG
AGCAGATTGCAGCCATCGCTCAAGAGCTGAATGAATTAGA
CTATCATGATGCTGCTACAGTGAACGCTCGCTGTCAGGGC
ATCTGTGACCAGTGGGACAATCTGGGGACCCTGACCCAGA
AGAGGAGAGATTCTCTGGAGCGTGTAGAAAAGCTTTGGGA
GACGATTGATCAGCTGTACCTGGAGTTCGCCAAGAGAGCA
GCTCCCTTCAACAACTGGATGGACGGAGCCATTGAGGATC
TGCAGGACATGTTCATCGTGCACAGCATCGAGGAAATCCA
GAGTCTGATCACAGCTCACGACCAGTTTAAAGCCACTCTT
CCCGAGGCCGATAAGGAGCGAATGGCCGTGATGGGCATCC
AGAACGAGATCGTGAAGATCGCTCAAACCTACGGCATCAA
GCTGGTCGGAGTCAATCCATACTCAGTGCTCAGCCCACAG
GACATCACCAACAAATGGGAGGCTGTCAAGCAGCTGGTTC
CCCTCAGAGACCAGATGCTGCAGGAGGAGGTTGCCAGGCA
ACAGGCCAACGAGAGGCTGAGACGCTCGTTTGCGGCTCAG
GCAAACATCATCGGACCCTGGATTCAGACCAAGATGGAGG
AGATCGGTCATGTGTCGGTGGACATCGCCGGCTCTCTGGA
GGAACAGATGAACAACCTGAAGCAGTACGAGCAGAACATC
ATCAACTATAAATCCAACATCGACAAGCTGGAGGGAGACC
ACCAGCTCATTCAGGAGGCGCTCATCTTCGACAACAAACA
CACCAACTACACCATGGAGCACATCCGTGTGGGCTGGGAG
CAGCTGCTCACCACCATCGCTCGCACCATCAACGAGGTGG
AGAACCAGATCCTGACCCGCGACGCAAAGGGCATCAGCCA
GGAGCAGCTCAACGAGTTCAGAGCCTCCTTCAACCACTTC
GACAGGAAGAGAAACGGCATGATGGACCCCGACGACTTCC
GCGCCTGTCTGATCTCTATGGGTTACGATCTGGGTGAGGT
GGAGTTCGCCCGCATTATGACCCTGGTGGACCCCAACAAC
ACCGGCGTGGTGACCTTCCAGGCCTTCATCGACTTCATGA
CCCGCGAGACTGCCGAAACCGACACTGCTGAACAAGTCAT
GGCCTCCTTCAAGATCCTGGCCTCCGACAAGCCCTACATC
ACCGTGGAGGAGCTCCGCCGCGAACTGCCCCCAGAGCAGG
CCGAGTACTGCATCAGCCGCATGACCAAGTACGTCGGCCC
CGAAGGAGCCCTTGGAGCCCTGGATTACATCTCCTTCTCC
AGCGCCCTCTACGGAGAGAGCGACTTATAAATGCTCTCAA
TGTCCTGCTTTTTCTCTTTCTTTTCTCTCATCCCTCTCTC
TTCTTGTTTTCTTCAAGCACCCCCAAATGTAGCTTTCAGT
CTGTGAAGGGAGTCAATAGTAATATCTCTCGTTTTCCCAC
TCATGAATATTCTCTGTCTTTCTGTCTAAAGCCCACACTG
CTAGCTTTAACTGCATTTGTATCTTACATCCACTCTGTAA
TAGGATGGAATTGCAATAATGGGGTTTTTAATCTTGTTGT
CCAGTCAAAAAAGTCTCATTTGAATGTCTGACGCGTTTTT
CCCCTCCAATAAGCATCACATCGTCTGAAGTCAGCATGGA
ATTGGATCAACCCTATTTATTCGTGTTCCTGTTCTTATTA
TGGATAATTATTCAATGCATTTTGTGCCTAAAAATATCTG
AAGCCCTTTTTTAAAAGATATCATCTAGGCTAGAAAAAAT
ATTTGGGCATAATTTTAGGCCAGTTTTCTTAGCGTGGGGT
TATGCTGTCTTGCTAAAATCTTATAGTAGTTAATGCACAC
TAACACATTAGCAAACTTTCCATCATTTTGAATAATAAAA
CAAGTCTTACCCTACATTTCTATTGTTAAATCAGGTCGCA
CTCACTTTATAAAAGTTAAACTGGTCGTTTCATGTTGACT
TCAGTATGCTTAGGCCAACTTTCTTATCTCTGTGCCTTAA
AAAACCTTCCAACATGATAAAAGATGCATTATAATGTGTG
TTTGTTAATTAATGAGTGCTTGTAAAGATGCATGTTGTGT
TTATTCTGCAGACATTAATATGTGAGAAGGGCCTGTTGCC
TCATTTGGTCTGTACTGTTTAAAAACCCCAAAAAGCACTA
CTGCTGTCCAGTGTCTTCTTAATTTGAAACTGTGAGAACA
ACTCAATAGTCTCTACACAGAACGTTTAGTGTCTGTATGT
TGTGTTGTCATCATGTTTCATCTTTTATCATTGTGTATTG
TGAATGTGGTGTTCAGAGGCAAATTCACTATTATTAATTT
GCCTTTTAATTGGGAAGTATTGTGCCAAATTATCAAACCA
AAGCCAGTAAATGAACTTGATGAAATGGCAAAGACTATGG
CAAAGTGTATGTGTTGCACTGACCTGAATGGCTTCTGAAA
GCTTAACAAGAACCAGGTTTGCTTTCAAACCGACAGTGAA
ATCCAGTGACACACACGACAGATTCGTTAAATTAAACCCT
GGATGTCACTGCAGTGAAACACCCTCTATCTCTTTGTATT
TAGATATACTCACGTCGATCATTTTAAGGAATAATTCACT
ATTAAGAATCATTTACTCACCCTCATGTTGTTCCAATGTG
TTAAGAAGGTGGTCTGTCAGAAAGTTTACATGACTCCATA
TCCTAGGTGTTGAAGAAATTATGTCTGTTTACATAATAAA
ACATAACAATATATGGACGATAACTAAATCGCAGCCGTTG
CTTCTTCTAATTCAAATATTCGCGCCCTTTGACGCTGGTG
TGATTCTGATTGGCTGTCAACGTTTTACCGTTTATCAGCG
GAGGAAAAAAGGTAAATTAATTACGCATGTTTGTCAATTT
TAGAGTTATCCACCCCCTTAAATAAAAGATAGAGGGTGTC
TGGTTCTTTAAAAGAGATGTTTGGGAAAGTTATGAAAGTT
TTGAAAGGAGGAAGAACGTCTTTGTCCTCAGGCAGGCCTT
GTTTATCAAGGATGTAGTTTCTATTGGCGATATTCGGATG
TTATTTGTCATTCAATATCAATCATGATGTTAAATCTGGG
TAAATGTATTTCACTGACCCTTCAGATCGCCTCATTGTGA
TCATCTCTGTCTCCTATATGGCCTCCAGGTATCTTCATTT
GCATTTTAAACGCAGACGATTAAAAAATAAACCGAAACGC
CCAGAATAAAACAGCTCAAACTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations