Transcript

mettl2a-002

ID
ZDB-TSCRIPT-090929-10150
Name
mettl2a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027602 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027602|OTTDARG00000021635|ZDB-GENE-050417-462 mettl2a|no_translation DKEY-229K5.1-002 LG_none BX769175.12,BX572620.15 Danio rerio protein_coding KNOWN, 759 bp
GTGCATCCGGTTCGCGTGTCCATCATGGCTGCTCCTGCTG
TTGCTGCTGATTCTCCAGTCATAGAAAATATGCCAGAAAC
TGCCGGTGGGGCCACGGAAAATTCAGCTGAGGCCCAGAAA
CGACCGCAGTTTGGCACTCGCTTCCTCACAGACCCGCGAC
AGGTGTTTCAGCACAACGCGTGGGATAATGTGGAGTGGTC
AGCAGAACAGGAGGAGGCTGCCTTGAAAAAAGTGCAAGAA
AACAGTCAACCTCTCCCAGCAGAAAAACAAGAGTTCCCCG
AGCTTGCACCTCAGCAAAAGCATTTACGGGGTGCTGAGGA
GAAGGAAAGCCTGGAACACATGTTAAATGGTGAAGATGTT
TCCTCGAATCACACACATGATGAATTTCCTGGAGCCTCTG
CATCCTATCGCATCCTGGAGGTGGGCTGTGGAGTAGGCAA
TACAGTCTTTCCCATCTTAAAAACCAACAATGACCCAGGA
CTCTTTGTTTACTGTTGTGATTTCTCCAGCACAGCTGTAG
ACCTCGTCAAAGTAAGTGACAGGAATTGAGCAATATGTGT
CCTCGAATAATAACTGGTTGTCTTTATGCATGTTTTGATA
CATTTTAGTTTTTTGGCAGTCAAATCCTGAGTATGACCCA
TCACGCTGTCATGCATTTGTCCATGATATGAGTGATGAAT
CTGGAGAGTATCCCATGCCAGATCACAGTCTGGACGTCAT
CGTCCTCATATTTGTGCTGTCCGCTCTGCACCCTGAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations