Transcript

basp1-201

ID
ZDB-TSCRIPT-090929-10145
Name
basp1-201
Previous Names
  • basp1-001
  • si:ch211-220f13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027597 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027597|OTTDARG00000021632|ZDB-GENE-070424-158 basp1|OTTDARP00000022599 CH211-220F13.1-001 LG_ BX005083.10 Danio rerio protein_coding KNOWN, 2450 bp
ACGAGTGTGCGCGCGAGAAATGCAGCGCGAGACACACACT
GAACAGCCCCGTTAAACCCCGCCGAATCCACGCGCACGGG
AAAAAAGACACTGGGAAAAAAACTGCAGCAGCTTCAGAAA
GGAGTGACAAGAAAGTCCACCGCCGACGGTCAGGTAAAAT
GGGAGGGAAGCTGAGCAAAAAGAAGAAGGGATACAATGTG
AACGACGAGAAGGCCAAAGAGAAGGACGCAAAGACAGAGG
GAGCGTCGGCGGAGGAGAGCGAAGCTCCTAAAGAGAACAA
GGAGGACGCTGCTGCTGCCACCGAGACCACCAATGACACG
GCGGCAGCAGCTAAAGAAGCCACACCAACCGCTGACAGCA
ACTCCACCGCACCCAAGGAAGAGGAGAAAAGCGCCGCCCC
TCCAAAAAAGGAGGAGCCTGCTGCAAATGCTAACGCTAAT
GCTCCTAAAGCATCTGATGCCAAGACCAGCGAGGCTGCCA
AAGCAGAACCCGCCAAAAGTCCAGATGCTCCTCCTGTAAA
AGCTGAAGAAAAGTCTGCCCCTTCCGCAGCTCCAGCCAAT
GAGAAAGAACCTGCGAAAGAGGCCGCTAAAGATCCCGCCC
CTGCTGTAGCCGCAGCGTCGGAGAGCAAGCCTGACGCTGA
GTCTAAAAAGACTGAGGCTCCGCCCACAAAGGAATCCGCC
CCCGCGGAGCCAATCACCACGGAGACCAGCCCCGCCCCCA
ACAAGGAGCAAGCAGTCGCTGTGCAGGATTAACGGAAGGA
ACAGTGAACGACAAGATGAAAACGGAGATCAAATCTAAAT
AATAAAACTAGCCCGCCCATTTTAAATGATACCAGTAATT
ATAACATCAATAATGATAATAGTAACAATAACAGTAATGA
TTTTAACAGGCTGGACTTTGATCATTGTGTTGGTGATGGA
CATGATCATGGTGAACAAGACTGGCTGTTATGACCTTATT
ATCTTTAATATCCAATTGAACTTTGATACAAATCACCAGC
CCCCAACTCTCCCTCCTTCTCTCTTCTTACCTTTCTTTCT
ACCTCCATTCGGTGAGGGGTGGAATAAAAACATTGAGTCT
ATTCATCACCACCCTCCATTCTCACTTCCCTTCATTTGAG
TGTGATATGATGGGTGGGGTTAAAAAAAAGATATATATAT
ATATATATATATAAGTGTGTGTGTGTGCGTGTGTGTGTGT
GCGTGTGTGTGTATGTATGTATGTATGTGTGTGCGTGAGT
AGTAGTAGTAGTTTAAGTCCAGCCTCCCGATGCATATTTC
ATATTTCCTGTTTGCTGCTTTAGTGATTGACATTGTGTCT
GCTTATCCCCTGACTCTCCTGCTTTCTTTGTTTCTCTCTC
TCTCTCTCTCTTTTTCTCACATATCAGTGGATACAAAATC
AGTGTACTGCACAATGCATTAAAACACACATATACATACA
CACACACGCACATGGCAGTATTAGTGTTTTTTAAAGGGAC
AGTTCACCCTAAAACAGCAATTCGGTTATGACTTTCTAAA
AAATCATGATGTTGGTTTTCCGCTAAATGCAAAAGGAGAA
ATTTAGCAGAAAGAGTTATGCACGAAAGTCTATGGACATC
CAAATCATTCAAGCAAGATTTTCATGGCAAAAATTGGGAT
ATAGTGCATGAGCCATATGGGCTACTTTATGGTGCTATTT
AGTCTTTTTTGGATTCACTTTTACTAGAAAAGAGCAGCAT
GAACCTTCTCCAAAACCTTCCCTTTGTTTTAGATGGACGA
AAATATTCCTAAGGGTTTGGAATGACTTGAGGAGAGTAAA
TGGTATCAGAACTGTTATTTTAATGGTGAGCTGTCACTTT
AAACGGATGTTTGAAGGTTCGATAACGTGTGTACATGTAT
GGAGGGATCTGGTTATATGAAACGAGAGTATGTATGGAGT
TATGCATGGTTTGAGTATGCATTTTCTGCATGTGTGTGTG
TGTGTGTGTGTGTGTGAAAAGAGTTCTGGTCTTTCTGTAG
TTTAAAAGCAGCATTTTGTCATGATGTCAGAGAGACAGAG
AGAGAGAGAGAGAGAGACAGTCCAGACCTCCAAACTCAAC
AAACAGAACACACTTCACACACACACATACACACACACAC
ACACCAGTCTCTCAATTTCCTGACAGAGCAGTGTGAACGT
TGTGTGTGTGTTTCTGTATGTGTGAGGTTGTGTGTTTTGC
ATGTCAGTGGTTGGCCCTATCGTTGTGTATTTTTGGTTGC
TGTGGAGATAATGTTGCTACAGGTGATATTTCATTTGAAT
TAACACACACTCTCTCTCTTTCTCTCTGTTTCTTTCTCTA
TCATTCCTTTTCTTTCTAAAATTCCCTGGTAAAATGAAAA
AAAAAACAACAAAAACAAATGGAAGAACTGAGATATATGT
ACTTGTATACATGGAGCAACCTTAATAAAATGGAAGAAAC
AGATTGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations