header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10139
Transcript Name: odf3l2a-201
Previous Name: zgc:110183-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027591 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027591|OTTDARG00000021629|ZDB-GENE-050417-380 zgc:110183|OTTDARP00000022595 DKEY-97A13.2-001 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 1163 bp
GCCGTCGTTTACAGACAACATGCCAGGCTGTAACTGCGGG
TGTCTTTTGTAGTCAGTGATGGATGTTTGGAAATCTGTAA
TGCGGAATGATATTGAGATGGAAGTTCTCGTCGCTCGGAC
AAGGATAATGTTTCTTGTGCTTGTAAGAGTCATTTATAAT
TCAGACGGCAGTTGTATCTCTTCACTGTGTCTAAACTGAA
ACTTCAACCTCTACCGGACCTCACTGAGCAAGTCTACTGG
CCATTTTTCTTCTCAGCTCTTTGAAACCAGCCAAAAAATA
ATCCCAGAAAAATATCCGCGACATGGCGGAGGTGGAGCGG
CGGCGGCGGCCCATCATCGCCGGGCGGGAACGGGGGCCCG
GGCCGGGGCGTTATGCTCTTCCGCCCACTATCGGTTACAT
AAACCATGACTACACCAAACCCAGCAGCCCGGCCTATTCC
TTCCACAGCCGCATGAGCAGCAACATGGTGTCTGTGGATT
CCAGTCCTGGGCCGCGGTATCGCGTGGATGCCAAAATGAC
GCGCTTTGGCAGAGACGGGACCCCGTCGTACTCCATGCTG
GGTAGAAGGAAGAGAACAGCTAGTACCTTCCAGACTCCAG
GACCAGGAGCCTACAGTCCTGAGAAAGCTCCACCTTTAAA
CCTCCACCACAGACCTCCATCTTACACCATGTCCTCCCGC
ACGCGCTACCGCAGTGTGGATCCTGTACCAGCACCTAACC
GCTACACCTTACCCAATCTCTTCGGTACCACAGTGTCCTG
CAAACCCTCCAGCCCCTGCTTCACCATGTCTGCTCGCATG
AAAGCAGGCGGCCCGTCTGAAGATCTGTCCATGACCCCGG
GGCCAGGCCGGTACAACAGCACAGACCCCAGCGTTTACTT
GAACAGACAGCCTTCCTTCTCCATGCAGAGCCGTCATAAT
ATTCTCATCGACAGCACCGGGAAGCCTGGTCCGGGTACGT
ACAGCTCTGAAAAGGTGACGGCGCACCTGCCCCGAGCACC
ATCTGTTTCTCTGGGGGTCCGTCACTCCGAGTTTGTAACG
CCACTGATTGTTGATGTATTAGATTAAATTGAGACGACAT
GGGTGTATTAGATGCGTGTTAGATCACAGAGTGTTTACAA
GAATTTTAAGGGGAAAATAAAGAGAAGTGTGAGGAACTAC
TGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
odf3l2a-201 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027591 (1),  Ensembl_Trans:ENSDART00000023208 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC092779 (1) 1073 bp
GenBank:EE326460 (1) 844 bp
CITATIONS (2)