ZFIN ID: ZDB-TSCRIPT-090929-10099
Transcript Name: tmem53-201
Previous Names: tmem53-001, zgc:92204-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027547 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027547|OTTDARG00000021603|ZDB-GENE-040718-384 tmem53|OTTDARP00000022564 DKEY-154P10.2-001 LG_ BX323807.8 Danio rerio protein_coding KNOWN, 1331 bp
TGTAAATCGTGACCCGGATGTTGTATGTAACAATGAGACG
CTGATGTTGTCTTGTTCATTCGTGCAGTATTATCGTGTGT
GCTGTGTGTGTCTGTCCTCTCAGCAGCGCAACCAGAGTGA
AACACGACACTCATTTGAAGTGAATTATTAATGGCAGACA
GACGATTGTGGAAATAATTGCCAATATGGGGGATGATGAC
TTAGACTACAACATAGTTTTTTCAGAGGCACTGATCTCAG
AGAAACACTGGCGTGGATCGAAGGAGCCAGTCGTTATTCT
GCTGGGCTGGGCGGGCAGCAGAGACAAGCACCTCGCCAAA
TACAGCTCTATTTACAACGAACAGGGTTGTACGACTCTAC
GCTACACGGCTCCTTTAAAGACGGTTTTTATTTCAGAATC
ATTGGGCTACAAGGAGCTAAGAAGCACTGCACACAAACTA
CTCGAACTTCTGTATGACTACGAGGTGGAAAACAACCCGA
TCTTCTTCCATGTGTTCAGCAACGGGGGCTTCATGCTTTA
CCGCTACATGGTTGAGTTGCTGCACAGTCACAAGCAGTTC
AGCACTCTGTGTGTGGTGGGCACAGTTGTGGACAGTGCTC
CGGGCAGCCAAAACGTCGTAGGGGCCCTCAGAGCACTCAA
AACCACTTTAGGGCCCAAAGTGAACGTGCTACTGCAGTAC
TTCCTCCTGGCACTGTTTGCTGTTGCGGTTTTCCTCCTCA
GGATTGTTTTGTATCCCTTGACCAAGTATTTTCACAGGAA
CCACTATGATGCTATGATGGAGCATCCAGCGCCGTGGCCT
CAGATGTATCTCTATTCCAGAGCAGACCGCGTGATCCGCT
ACAGGGACGTGGAGAAGATGGTGAAAGGGTTGCAGGAGAA
AGGGCTGATGGTTGAAAGTTTTGATTTCATCACCCCTGCA
CACGTGAGCCTGTTCAGAGACTGTCCCGAGGACTATTCTA
ATAGATGCAGGACGTTTCTGAGCCACTGCATGACTACTTC
AGAGGAGATCTTGATGAAAAAGCATCACTAATTATGCAGT
TCATGACTGGCTCATTAATATACTCGCTGTACACTTTTTT
TATCGTGTACAAACTACCCTATTTGTGAAATAAAAGCACT
GCTGTTTAATATAATCAACTTATCTCAAGCCGTACATGAG
GTTTTTAACAGGGGTCTACAACAACTTATCTCCGAAGTAT
TTTTGTCTTATGCTGTGAAATGATTTGTAAATTAGGGAGT
TGTTGATTTGTAACATTGAGATTTTTAGATATTGTGTACG
AGTAATTTTTTGTTGTCTAGACATTGTGAATGAATAAATT
AATATATTTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem53-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000027547 (1),  Ensembl_Trans:ENSDART00000056649 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC075937 (1) 1317 nt
GenBank:CO935267 (1) 779 nt
CITATIONS (2)