Transcript

hirip3-201

ID
ZDB-TSCRIPT-090929-10004
Name
hirip3-201
Previous Names
  • hirip3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027447 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027447|OTTDARG00000021545|ZDB-GENE-030131-5753 hirip3|OTTDARP00000022479 hirip3-001 LG_ CR855387.11 Danio rerio protein_coding KNOWN, 1948 bp
AAATTGTGACATGAACACGCGTCAGAATGAAAGTGTGCGT
AATGACGTAAAGCAGCGTGGCCGTGCACAGCAAAGCGCGC
CAAGGTTGGGTCGCGCGCTTAGCACGCAGGGAGTACGCAG
TGTTGTAAAAGTGGCACAAATGCATGAAAAAACATGGCCA
AAGAAAAGGACGCGATAAGAAAGTTTGTTGTGGCTCAACT
GCAGAAGTGCTCGGACCTCAGCACACTGACTTTAGGCATT
CTGAGGAGGAGATACCTGGAGAAAGTGGGAAGAGAGTCGC
TCAGTGCACAGGACAGACAGCTGATGAAGGTTATTGTTGA
GGAGGAGCTTTTGAAGATGCAGGCTAGCAGTGACGATGAG
CCTCTTATTAAGATGGTGAATCCATCAAAGACCCAGAGCA
AAAGAAAAAGAGTGGATGATGAAGACGATGAGGAGGAAGA
GAGGAAAGTGATGGATAGGACAAAGCGATCACGGCTGGAG
GAGTCTCCTCCACCAGATTCCCCCGACTCAGGCATAGAGA
AGGCTATGAATGAGGTAGGACATAAAGAAGAAGCGGGAAG
TGATAAAGACACAGATGAAGACAGTGAGGAGGAGGAGAAA
GAGAAAATGAAGGGAAAACCACAGAAAAAGAAAGGAGGGA
AGAAAAGCCCACAGGTTGAAGACAACAGGAAGAAAAAGAA
ACTAAAGAAGAAGACGATTGAAAGTGATGAAGATGAGGAG
TTGGAGGATTCTGAGGAGGAGGAAAGACAAAAACCGAAAG
AGAAAGAGGATTCAGACAGCGAGGAAGCGGCTAAAAGTGA
CTCTGCGAGCGATTCTGAGGACGAAAAACCGAAGAGCAAA
ACAAAGACACCGAGCAAGAGAAAAGATATAAGAAAAAAGA
AGCCAGTTGAGAGGGATGTCGTGAAGGAAGTGGAGAGAGA
GGTATTTGGGAGCAGCTCGGAGAGTGAAGAGGAGAAAAAC
CAGAGCGCTAAAATAAAAAATGGCAGCATCTCTGAAGATG
AAAGTGCTGGAGACAGTGACGAGGAGAGAGATAAGAGTGA
AGATGCTGCTGGTTTACCCTCTAAAGAGACGAAGAATAAT
GAGAAGTTACGGGACGGTCAGGAGGAAGCAGAGGACTCTG
ACTCCTCATCTCTTCCCTCACTGGAGGACGAGGAGGAGCA
GGAGAAAGAGAAGACCAAGAAAGAGGGGAAGAAAAGCGTG
AGAAAGAAGAGCAGCGAAGAGAGGGAGAACACATCCAGAG
GAAAGGATGAGGAGAATAAGGCTGTGTCCAGACTGAAGCG
CTACATCGCCCTCTGTGGAGTGAGACGAAACTACAAAAAG
CTGCTGGATGGCTGTCGATCTGTAAAGGCAAAGGTGGCTG
TGCTGAAGAAAGAGCTGGAGGAGCTGGGTGTGGAAGGTCA
GCCCTCGATAGAAAAGTGCAAAAAAGCTCGACTAAAGAGA
GAAGAAGCGCAAGAGCTGGCTGAGCTGGACATGAGCAACA
TCATCACCACTCAGGGACGACCCAAAAGGAGAGCAGCAGC
AGCAGCAGTGTGGCCCCCGGCCCAGAATGCCTCCCCTCCC
TCCTCCGCTTATAAACGTGTTGTGGACTCTGACTCGGACA
GTGGAGACAGTCACACAAACAGGGGCCGCAAGAGAGGAGC
CTGGGCCAACCTACACGGCATCATTAGTGATGATGGAGAC
AGTGAGTAGATGGCCAGTCCCGTCTATCTACAGTCCATTC
CGTGAGTTCACTCCATTTCACAAGGAACTCTGTAAATCTG
TTCAACTTGCTCTTATACATCAATCTGTTCCTGGGCAAAG
TAATTTTATGTGTGTGCTCCTGTGATTTCATTCCAACGTC
TTTGTGTTTTTTTCTTACGTGTTTTATAATGGTCAGTTTG
TACTTTGAACGATATTTAAGTGTCTTAAATGTGTTAAATA
AGGTGTATGCAGCTTTGAAAATAAAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations