ZFIN ID: ZDB-TALEN-180508-3
TALEN Name: TALEN1-kctd15b
Target: kctd15b (1)
Source:
Target Sequence 1:
5' - CAGCAGGCTGTTTAAC - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TGCTGCTTTAAACTGTCCAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-kctd15b No data available
GENOMIC FEATURES CREATED WITH TALEN1-kctd15b
Genomic Feature Affected Genomic Regions    
y585 kctd15b    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-kctd15b No data available
PHENOTYPE
Phenotype resulting from TALEN1-kctd15b
No data available

Phenotype of all Fish created by or utilizing TALEN1-kctd15b
Phenotype Fish Conditions Figures
migratory neural crest cell increased amount, abnormal ba2Tg ; kctd15ay584/y584 ; kctd15by585/y585 control Fig. 1 with image from Heffer et al., 2017
neural crest snai1b expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 1 with image from Heffer et al., 2017
head pigment cell gch2 expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 3 with image from Heffer et al., 2017
cranial cartilage morphology, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 4 with image from Heffer et al., 2017
melanocyte increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 2 with image from Heffer et al., 2017
maxilla decreased length, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 4 with image from Heffer et al., 2017
barbel absent, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. S6 with image from Heffer et al., 2017
maxilla malformed, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 4 with image from Heffer et al., 2017
neural crest sox10 expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 1 with image from Heffer et al., 2017
whole organism kctd15b expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. S1 from Heffer et al., 2017
migratory neural crest cell zgc:91968 expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 2 with image from Heffer et al., 2017
whole organism decreased size, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 5 with image from Heffer et al., 2017
neural plate border dlx3b expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 1 with image from Heffer et al., 2017
neural crest foxd3 expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 1 with image from Heffer et al., 2017
frontal bone decreased length, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 4 with image from Heffer et al., 2017
neural crest tfap2a expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 1 with image from Heffer et al., 2017
whole organism kctd15a expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. S1 from Heffer et al., 2017
xanthophore increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 3 with image from Heffer et al., 2017
dentary decreased length, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 4 with image from Heffer et al., 2017
migratory neural crest cell tyrp1a expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 2 with image from Heffer et al., 2017
torus lateralis absent, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 6 with image from Heffer et al., 2017
neural crest sox9b expression increased amount, abnormal kctd15ay584/y584 ; kctd15by585/y585 control Fig. 1 with image from Heffer et al., 2017
whole organism decreased length, abnormal kctd15ay584/y584 ; kctd15by585/y585 standard conditions Fig. 5 with image from Heffer et al., 2017
Genome Resources:
CITATIONS (1)