header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-140728-1
TALEN Name: TALEN1-kctd10
Target: kctd10 (1)
Source:
Target Sequence 1:
5' - TGTGTGCTTCTGCAACATCCT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - GACACTCATCTACCAGGCCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-kctd10 No data available
GENOMIC FEATURES CREATED WITH TALEN1-kctd10
Genomic Feature Affected Genomic Regions    
zf559 kctd10    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-kctd10 No data available
PHENOTYPE
Phenotype resulting from TALEN1-kctd10
No data available

Phenotype of all Fish created by or utilizing TALEN1-kctd10
OTHER TALEN1-kctd10 TALEN PAGES No links to external sites
CITATIONS (1)