ZFIN ID: ZDB-SNP-060626-914
SNP Name: rs3729285
Previous Name: zsnp1823 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
NNNNNNNNNNNNNACTGGCTTGAACAGCTTGAATCCAGGCCTGCCGGAG
Y
TTCTCAGACTCTGCCTGCAGCATACAGCTCCTACAATACACATCCACACAA
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3729285 Contained in: [Gene] acap3a (1)
[EST] fb78d09 (1)
Genome Resources: dbSNP:rs3729285 (1)
CITATIONS (2)