header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-910
SNP Name: rs3727656
Previous Name: zsnp182 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
NNTAGCATACTTTTTTTTTCCCCCCGCATCTGCAAGTCATCCGTCTTTA
Y
GATTTTTGTTTTAAGGAAATTTACTACCGTATCCCAAGAGGCTGAGATCCA
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 2 Details
MARKER RELATIONSHIPS
rs3727656 Contained in: [Gene] cdc34b (1)
[EST] fe17e09 (1)
OTHER rs3727656 SNP PAGES
  • dbSNP:rs3727656 (1)
  • CITATIONS (2)