header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-828
SNP Name: rs3729208
Previous Name: zsnp1746 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
CTGCAGGGACACAAAACACATGATTTTATTTGATTACAGGTTTCTTGAC
R
TCAAATGTAAGACATTAAGACCAACTGGAGTTGAATTAAAAAGCTATATCA
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3729208 Contained in: [EST] fc30d07 (1)
[Gene] smc3 (1)
Genome Resources: dbSNP:rs3729208 (1)
CITATIONS (3)