header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-748
SNP Name: rs3729136
Previous Name: zsnp1674 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/C
Sequence:
AAACAGCCCCCAACATAATAAAAGGGAAGTCATTTGAACAGTACATCAC
M
TACCCAAACTGCCCTTCCAGCTGCGGTCTTCCCTGCGCTCCTCCGTGATCG
 (SNP highlighted)
M = A/C
Select Sequence Analysis Tool
Location: Chr: 21 Details
MARKER RELATIONSHIPS
rs3729136 Contained in: [Gene] amot (1)
[EST] fj21a07 (1)
OTHER rs3729136 SNP PAGES
  • dbSNP:rs3729136 (1)
  • CITATIONS (2)