ZFIN ID: ZDB-SNP-060626-747
SNP Name: rs3729135
Previous Name: zsnp1673 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/T
Sequence:
ATAAAAGTCAAAAACTTTTTTGCAAACAATCAAGAATGCATCAAAAAAA
W
GTGGTTACAATGGAAGTCATTGGGGGGAAAAACAGCCCCCAACATAATAA
 (SNP highlighted)
W = A/T
Select Sequence Analysis Tool
Location: Chr: 21 Details
MARKER RELATIONSHIPS
rs3729135 Contained in: [Gene] amot (1)
[EST] fj21a07 (1)
OTHER rs3729135 SNP PAGES
  • dbSNP:rs3729135 (1)
  • CITATIONS (2)