ZFIN ID: ZDB-SNP-060626-745
SNP Name: rs3729133
Previous Name: zsnp1671 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
TCAAGAATGCATCAAAAAAAAATGTGGTTACAATGGAAGTCATTGGGGG
R
AAAAACAGCCCCCAACATAATAAAAGGGAAGTCATTTGAACAGTACATCAC
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Chr: 21 Details
MARKER RELATIONSHIPS
rs3729133 Contained in: [Gene] amot (1)
[EST] fj21a07 (1)
OTHER rs3729133 SNP PAGES
  • dbSNP:rs3729133 (1)
  • CITATIONS (2)