ZFIN ID: ZDB-SNP-060626-622
SNP Name: rs3729022
Previous Name: zsnp1560 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: G/T
Sequence:
GTTGTGCGGTTCAAAATGAAATGGAGTCCCCCCAATGAGGACATAAACA
K
CAGCTATATTTGAAAAGCTGGTTCCATTTGATAGATATGTTTGTTTCATGC
 (SNP highlighted)
K = G/T
Select Sequence Analysis Tool
Location: Chr: 20 Details
MARKER RELATIONSHIPS
rs3729022 Contained in: [Gene] eif2b4 (1)
[EST] fb54a09 (1)
OTHER rs3729022 SNP PAGES
  • dbSNP:rs3729022 (1)
  • CITATIONS (2)