ZFIN ID: ZDB-SNP-060626-620
SNP Name: rs3729021
Previous Name: zsnp1559 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
NNNNNNNNNNCCTGTCATTTAAAAAACACATCTAGAATAGGACCAGTTG
Y
GCGGTTCAAAATGAAATGGAGTCCCCCCAATGAGGACATAAACAGCAGCTA
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 20 Details
MARKER RELATIONSHIPS
rs3729021 Contained in: [Gene] eif2b4 (1)
[EST] fb54a09 (1)
OTHER rs3729021 SNP PAGES
  • dbSNP:rs3729021 (1)
  • CITATIONS (2)