ZFIN ID: ZDB-SNP-060626-581
SNP Name: rs3728985
Previous Name: zsnp1522 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
GCGTCCTTTACACTGGTCATGTGTGTTCATTAAGTATCAATTGTCAACA
Y
GTGCCGGACACTGAATTGTAGTCCTTAATAAGATCGATCAGTGATAAATAG
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 19 Details
MARKER RELATIONSHIPS
rs3728985 Contained in: [Gene] bloc1s4 (1)
[EST] fa20a04 (1)
OTHER rs3728985 SNP PAGES
  • dbSNP:rs3728985 (1)
  • CITATIONS (2)