ZFIN ID: ZDB-SNP-060626-553
SNP Name: rs3728961
Previous Name: zsnp1497 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
CTCTCTGCACAATCTTCAGGATATCGCTGTAGTCTGGAGGATTGAGAAG
R
GCTTCTGAACTGTTGATGAAACGCTCAACCTTCTTNNNNNNNNNNNNNNNN
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Chr: 19 Details
MARKER RELATIONSHIPS
rs3728961 Contained in: [Gene] daxx (1)
OTHER rs3728961 SNP PAGES
  • dbSNP:rs3728961 (1)
  • CITATIONS (2)