ZFIN ID: ZDB-SNP-060626-54
SNP Name: rs3728511
Previous Name: zsnp1046 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
GCAGAGTGCTTGGCTGTTTCCAGTATTCTCCTGATTGCTCCTGTGTAAC
R
CCCCGATTTGTTTAAATTTGGCTGCTGCGTTTTTATTTGCAGAAACATCTT
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3728511 Contained in: [EST] fb51a05 (1)
[Gene] srsf2a (1)
OTHER rs3728511 SNP PAGES
  • dbSNP:rs3728511 (1)
  • CITATIONS (2)