ZFIN ID: ZDB-SNP-060626-536
SNP Name: rs3728945
Previous Name: zsnp1481 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
GGCAACATTAGTGTGTGTGTGGTTTTACAGTTTCCAGCATGGTGTCATC
R
GTGTGTGCGTGTTGATCATGAGTGCCCGATGAGTGAGAGTGCAGTGTCGGG
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Chr: 19 Details
MARKER RELATIONSHIPS
rs3728945 Contained in: [Gene] ehmt2 (1)
[EST] fb63b12 (1)
OTHER rs3728945 SNP PAGES
  • dbSNP:rs3728945 (1)
  • CITATIONS (2)