ZFIN ID: ZDB-SNP-060626-53
SNP Name: rs3728510
Previous Name: zsnp1045 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
TTAAGGTGGCGTGTTGCGGTGCAGAGTGCTTGGCTGTTTCCAGTATTCT
Y
CTGATTGCTCCTGTGTAACACCCCGATTTGTTTAAATTTGGCTGCTGCGTT
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3728510 Contained in: [EST] fb51a05 (1)
[Gene] srsf2a (1)
OTHER rs3728510 SNP PAGES
  • dbSNP:rs3728510 (1)
  • CITATIONS (2)