ZFIN ID: ZDB-SNP-060626-479
SNP Name: rs3727617
Previous Name: zsnp143 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/T
Sequence:
GGGAGCCTCCAGCGTTGTCTGAACGTAACGGACGGATCATACATTACAT
W
GTGGTTTACCGAGACATCAACAGCAAACAAAACAGCACCAACCGAACCTCC
 (SNP highlighted)
W = A/T
Select Sequence Analysis Tool
Location: Chr: 2 Details
MARKER RELATIONSHIPS
rs3727617 Contained in: [EST] fj23e12 (1)
[Gene] ptprfb (1)
Genome Resources: dbSNP:rs3727617 (1)
CITATIONS (2)