ZFIN ID: ZDB-SNP-060626-468
SNP Name: rs3727616
Previous Name: zsnp142 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
NCTCGGAGAGGAGTACGTTAAAGACATCGGCACTCCTGAGGACGTGCCCAG
Y
GGGTTTCCTCTTAACCTGCAGGTCGTAGGCTTGACTACCTCTACCACCC
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 2 Details
MARKER RELATIONSHIPS
rs3727616 Contained in: [EST] fj23e12 (1)
[Gene] ptprfb (1)
Genome Resources: dbSNP:rs3727616 (1)
CITATIONS (2)