header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-4
SNP Name: rs3728465
Previous Name: zsnp1000 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/C
Sequence:
CCAAACCTCTTCCCCCTGAATCATCTTTACCCCCTGTTCCAACCCGTCA
M
AGCCCACCTCCATCAGAGGACCCATATCGTCCCAAATTGGACTCTACGTT
 (SNP highlighted)
M = A/C
Select Sequence Analysis Tool
Location: Chr: 12 Details
MARKER RELATIONSHIPS
rs3728465 Contained in: [Gene] foxh1 (1)
OTHER rs3728465 SNP PAGES
  • Ensembl_SNP:rs3728465 (1)
  • CITATIONS (2)