header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-322
SNP Name: rs3728753
Previous Name: zsnp1289 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
ACATTATCAGTTCATCTCCAGCTCGCTCTCTTCACCGTCAGTAATGACC
Y
CCTCAACGGTAACACAAACATCAGGGTAAACTGAGTTACAGTTCATACTCA
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3728753 Contained in: [Gene] mpzl3 (1)
[EST] zeh0677 (1)
OTHER rs3728753 SNP PAGES
  • Ensembl_SNP:rs3728753 (1)
  • CITATIONS (3)