header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-1761
SNP Name: rs3728222
Previous Name: zsnp757 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
GCAAGCAGGTGTGCAGTGGTCGTGGTGAATGCAGCTGTAACCAGTGCCT
R
TGCTATGAGTCCGAGTTTGGCAAGATCTACGGCACCTTCTGCGCNNNNNNN
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Chr: 9 Details
MARKER RELATIONSHIPS
rs3728222 Contained in: [EST] fi30h12 (1)
[Gene] itgb5 (1)
OTHER rs3728222 SNP PAGES
  • Ensembl_SNP:rs3728222 (1)
  • CITATIONS (2)