ZFIN ID: ZDB-SNP-060626-1746
SNP Name: rs3728208
Previous Name: zsnp743 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/T
Sequence:
CCGCGGGACACTGCTCTGTCTGTGCAGGGAAAGGGCTAGGGGTGCTGGT
W
TGATCCTGCACATGACCCCGCGGCTGCACCGACGAGCCCTGGACAGTGCTA
 (SNP highlighted)
W = A/T
Select Sequence Analysis Tool
Location: Chr: 9 Details
MARKER RELATIONSHIPS
rs3728208 Contained in: [Gene] hoxd4a (1)
OTHER rs3728208 SNP PAGES
  • Ensembl_SNP:rs3728208 (1)
  • CITATIONS (2)