ZFIN ID: ZDB-SNP-060626-1745
SNP Name: rs3728207
Previous Name: zsnp742 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
ACCGCGGGACACTGCTCTGTCTGTGCAGGGAAAGGGCTAGGGGTGCTGG
Y
ATGATCCTGCACATGACCCCGCGGCTGCACCGACGAGCCCTGGACAGTGCT
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 9 Details
MARKER RELATIONSHIPS
rs3728207 Contained in: [Gene] hoxd4a (1)
OTHER rs3728207 SNP PAGES
  • Ensembl_SNP:rs3728207 (1)
  • CITATIONS (2)