ZFIN ID: ZDB-SNP-060626-1630
SNP Name: rs3728104
Previous Name: zsnp639 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
AAAATAAGCTTACGTTGTACCTGCTCCCCCAGCAGTGCAGTCCACAGTC
Y
GCTTTGTGTTTAGATTCATGTATTATCTAAAAACCATTCCATTTAAAAAAG
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 7 Details
MARKER RELATIONSHIPS
rs3728104 Contained in: [Gene] ccnd1 (1)
Genome Resources: Ensembl_SNP:rs3728104 (1)
CITATIONS (2)