ZFIN ID: ZDB-SNP-060626-1531
SNP Name: rs3727529
Previous Name: zsnp55 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
CGCTTCACAGTCTGTGGTGTGACTAAGCCACTGATACACTTCTTCAACC
R
ATTTATTATTGCACTGCACATCCACACTGAATGATCAATTACTAGCATTCA
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3727529 Contained in: [Gene] tyrp1b (1)
[EST] zeh0659 (1)
OTHER rs3727529 SNP PAGES
  • Ensembl_SNP:rs3727529 (1)
  • CITATIONS (2)