SNP

rs3727955

ID
ZDB-SNP-060626-1456
Name
rs3727955
Symbol
rs3727955
Previous Names
  • zsnp482 (1)
Variant Allele
A/G
Sequence
GAGTTTCTTGAATTTTAGCAATAATTGTTTCACAAGTGTAGTTGCTAGG
R
ATTCTTGTGCAGGCAAGAGCAGCAGACCTCCTTTCANNNNNNNNNNNNNNN
R = A/G
Location
Chr: 6 Mapping Details/Browsers
Genome Resources
Note
None
Marker Relationships
Citations