ZFIN ID: ZDB-SNP-060626-1446
SNP Name: rs3727946
Previous Name: zsnp473 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/G
Sequence:
TTGACATCAAGGTGACCTTTTACATCACAAACCCTGAGCTTGTGATCAT
S
TCTTTTGACAACTCTCTCCACCAATCCCAGGGTGNNNNNNNNNNNNNNNNN
 (SNP highlighted)
S = C/G
Select Sequence Analysis Tool
Location: Chr: 6 Details
MARKER RELATIONSHIPS
rs3727946 Contained in: [Gene] ihhb (1)
OTHER rs3727946 SNP PAGES
  • Ensembl_SNP:rs3727946 (1)
  • CITATIONS (2)