ZFIN ID: ZDB-SNP-060626-1445
SNP Name: rs3727945
Previous Name: zsnp472 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: G/T
Sequence:
ACTAAGTTGGCAACACTGTTCAACTGACATCAAATTAATTTCCATTTTT
K
ACATTTTTAATGTGTTTTTGATGTCGTTTTGACATCAAGGTGACCTTTTAC
 (SNP highlighted)
K = G/T
Select Sequence Analysis Tool
Location: Chr: 6 Details
MARKER RELATIONSHIPS
rs3727945 Contained in: [Gene] ihhb (1)
OTHER rs3727945 SNP PAGES
  • Ensembl_SNP:rs3727945 (1)
  • CITATIONS (2)