ZFIN ID: ZDB-SNP-060626-1301
SNP Name: rs3727815
Previous Name: zsnp342 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: G/T
Sequence:
CTACTTGTGTCTTGTGAATGTGCCATCAGATGTTTTATCCCACATTTTT
K
TTTTGTATTCCCAGGATCAGATGAATGATGTTTTGATGCCGATGGACTCCG
 (SNP highlighted)
K = G/T
Select Sequence Analysis Tool
Location: Chr: 5 Details
MARKER RELATIONSHIPS
rs3727815 Contained in: [EST] fi22e08 (1)
[Gene] ppp1cc (1)
Genome Resources: Ensembl_SNP:rs3727815 (1)
CITATIONS (2)