ZFIN ID: ZDB-SNP-060626-1243
SNP Name: rs3727763
Previous Name: zsnp290 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
GCGGAAAGGGGTTTTTATATCCCGGAGCTTTGACGACGCACCAGAAAAA
R
CACTCTAAAGGTAACCCAGAGCATTGCACACAGTGTGACTCCAGTACGGAA
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3727763 Contained in: [EST] fc21a11 (1)
[Gene] si:dkey-14k9.3 (1)
Genome Resources: Ensembl_SNP:rs3727763 (1)
CITATIONS (2)