header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-1183
SNP Name: rs3727709
Previous Name: zsnp235 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/C
Sequence:
CGGACAAAACATGGCGTAAGCTCATTACGGGAAAAGCTTATTAAAAATT
M
ATTTCAGAAACACTTATGTTGCCACTTTTAAAAACATTTACATAATACTA
 (SNP highlighted)
M = A/C
Select Sequence Analysis Tool
Location: Chr: 3 Details
MARKER RELATIONSHIPS
rs3727709 Contained in: [EST] fb22g02 (1)
[Gene] kat8 (1)
Genome Resources: Ensembl_SNP:rs3727709 (1)
CITATIONS (2)