Regulatory Region
rr.tbx2b.t1
- ID
- ZDB-RR-191028-3
- Name
- tbx2b regulatory region t1
- Symbol
- rr.tbx2b.t1
- Previous Names
- None
- Type
- regulatory_region
- Location
- Unmapped
- Note
-
Region -3579 to -3565 upstream of tbx2b. Sequence: GAGTGGGAGAGAAG. Contains consensus-like CNBP binding sites. A 30 nucleotide fragment that includes the 14 nt motif and 8 nt flanking sequence interacts with CNBP (GATGGAGAGAGTGGGAGAGAAGAAGCAGAG). CNBP immunoprecipitated a fragment that includes "t1" in ChIP assays.
Mutations and Sequence Targeting Reagent
Mutants
Sequence Targeting Reagents
Gene Ontology
Constructs with Sequences
Interactions and Pathways
Marker Relationships
Sequence Information
Orthology
Citations