Morpholino

MO1-marchf5

ID
ZDB-MRPHLNO-200812-3
Name
MO1-marchf5
Previous Names
  • MO1-march5
Target
Sequence
5' - TTTGTTTCTTTCACTTACCTGTCCACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-marchf5
Phenotype
Phenotype resulting from MO1-marchf5
Phenotype Fish Figures
axial chorda mesoderm tbxta expression spatial pattern, abnormal WT + MO1-marchf5 Fig. 4 from Jung et al., 2020
convergent extension process quality, abnormal WT + MO1-marchf5 Fig. 4 from Jung et al., 2020
diencephalon ventral region emx3 expression absent, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
eye decreased diameter, abnormal WT + MO1-marchf5 Fig. 2 from Jung et al., 2020
forebrain neural keel rx3 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
forerunner cell group sox17 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 4 from Jung et al., 2020
midbrain hindbrain boundary decreased distance rhombomere 3, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
optic primordium rx3 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
telencephalon emx3 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-marchf5 Fig. 2 from Jung et al., 2020
whole organism dorsal region gsc expression decreased amount, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism dorsal region chrd expression decreased distribution, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism ventral region bmp2b expression increased amount, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism ventral region bmp2b expression increased distribution, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
Phenotype of all Fish created by or utilizing MO1-marchf5
Phenotype Fish Conditions Figures
forebrain neural keel rx3 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
whole organism ventral region bmp2b expression increased distribution, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
whole organism ventral region bmp2b expression increased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
axial chorda mesoderm tbxta expression spatial pattern, abnormal WT + MO1-marchf5 standard conditions Fig. 4 from Jung et al., 2020
eye decreased diameter, abnormal WT + MO1-marchf5 standard conditions Fig. 2 from Jung et al., 2020
whole organism dorsal region gsc expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
optic primordium rx3 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-marchf5 standard conditions Fig. 2 from Jung et al., 2020
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
convergent extension process quality, abnormal WT + MO1-marchf5 standard conditions Fig. 4 from Jung et al., 2020
forerunner cell group sox17 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 4 from Jung et al., 2020
diencephalon ventral region emx3 expression absent, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
whole organism dorsal region chrd expression decreased distribution, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
telencephalon emx3 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
midbrain hindbrain boundary decreased distance rhombomere 3, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
Citations